TABLE 2.

Primers used in this study

PrimerDNA sequence (5′-3′)
feo1CGCTGGCCAAAGTCATTGATTTGCCAGGAAC
feo2CGCTGGCCAGCCACTGCACTTGGTATAGG
Cj1395FCGATTGCGATCCTTTAGAAGCAAA
Cj1395RCGAGTGGTTTAAATTTTCTAGATTGATGA
Cj1397FCGACGCTCACAAAGAACTCAAAAA
Cj1397RCGAGCTTCATCAGATCTTAGGATAACACA
Cj1398FCGATCAGCCTAATGTAGGCAAAAGTC
Cj1398RCGATGCGTTCTAAATTGGTAGCATC
KmFGATAAACCCAGCGAACCATT
KmRTCTAGGTACTAAAACAATTCATCCAG
slyDRGTCCATGTCCGTGATGATGA
slyDLTGAAGCTTGATTGCCCTAGC
IlvCRTGATCCAAGGCATCATAGCA
IlvCLTAGGTGGTGGCACTCCTTGT