TABLE 1.

Primers used in the study

Primer namePrimer sequence (5′ to 3′)a
P1FAAATGCCCTTGTATGTAGCAATTACA
P1RCAGCTAGCAAAAATAACTAATAAACAACAT
P2FTTGCTAGCTTCTCTTAAGGCTAGTCCA
P2RAAGCTTAAGACCTGCTATCTTACAA
P3FAAGGTACCAATAACAGCAGAGAAAT
P3RTAGGTACCTGCTATCTTACAAAAAGACT
P4FCGCATGTAGTATTGGATTAG
P4RCATTGCTGAAAATTCACCAC
P5FTATCTAGAGCTTCAAGGAAGATTTCC
P5RAAATCTAGACGCTCAGTGGAACGAA
  • a P1R and P2F, P3F and P3R, and P5F and P5R contain restriction enzyme sites NheI, Acc65I, and XbaI (underlined), respectively.