TABLE 2.

Primer pairs used for gene cloning

Target regionNameSequence (5′-3′)a
htpGhtpGp2-fGGGGTACCTGAGGAGAATAGCGAGTT
htpGp2-r2CCCCCGGGTTGGGTTTTCAGCACAAC
wecAPG0106-DGCTCTAGATGCGACCTCAATCCTTC
PG0106-ECGGGATCCCAACCAGTGTTTGTCTCT
wbaPPG1964-AGGAATTCGGGATACTACAACAAACC
PG1964-CGCTCTAGAAGGCTCATATTCTCGTAG
galEPG0347-AGGAATTCGGATCCCATACGACTGTG
PG0347-CGCTCTAGAACGACTCCAAAGCTTTCC
wztPG1225-AGCTCTAGAGATCGGACTGCTTCTGGT
PG1225-BCGGGATCCTTTCGACGGTCTGCCTTTC
tetQSmaI-tetQ-FTCCCCCGGGCGTTCCATTGGCCCTCAAAC
BamHI-tetQ-RCGGGATCCCTCCTGCCATTCATAGAGGC
galE and its downstreamBamHI-down-FCGGGATCCGAAACCGAAATGAAACAAAAG
XbaI-down-RGCTCTAGAAGGACACCGCGCAGCTGGAT
Upstream of galEKpnI-up-FGGGGTACCCTCTCCAATGCCAGACTTTG
SmaI-up-RTCCCCCGGGCGGTTTCTTATTTCGTAGC
  • a Restriction enzyme sites incorporated into oligonucleotides for subcloning are italicized.