TABLE 2.

Oligonucleotides used in this studya

Name and procedureNucleotide sequence (5′-3′)Gene or target
PCR
    MKM1CCAGTGCTAATGGGATTATCAATFTT0232C
    MKM4GGTTCTCATAAGCGATATCATTAFTT0232C
    MKM5GGTAATGATCTAGAAGATGCGAAFTT0231C
    MKM6GGTATCTGGATTGTCGTTGGTTAFTT0232C
    MKM7GGTCTGGTTCTATAGCGACGATFTT0232C
    MKM8GCCGCACTGGCTGCTGAAFTT0231C
    MKM82GTACCCCGGGGGAGCATACCACATAGAGACFTT0232C
    MKM83CATGCCCGGGGGTATCTGGATTGTCGTTGGFTT0232C
    MKM85CAGTGGATCCGGCTGTTTGCCTATGCTTATACAFTT0232C
    MKM86CTGAGGATCCGGTATACCTATAGATGCAAGAATAFTT0232C
    MKM104bGCACTCGACTGCAGGGATCTTCTTGAGATCCTTToriE
    MKM105CCGAGCTACTCGAGTATACTTTGGCGTCACCCCTsacB
    MKM106GACTCTCGAGCTGCACGACGAACTAATACTgroEL promoter
    MKM107CGTCCTCGAGCCGATTTAGAGCTTGACGGF. tularensis ori
    MKM128AGAATATCACCGGAATTGAAAAAACaphA-3
    MKM129TGATCCCCAGTAAGTCAAAAAATAGaphA-3
    MKM130CATCTGCAGCGATTTTCGTTCGTGAATACaad(9)
    MKM131CATCTCGAGAAGGTGTTTCCACCATTTTTTCaad(9)
    SPECRupCGATTTTCGTTCGTGAATACaad(9)
    SPECRdownAAGGTGTTTCCACCATTTTTTCaad(9)
    M13 forwardGTAAAACGACGGCCAGMCS, pCR2.1TOPO
    M13 reverseCAGGAAACAGCTATGACMCS, pCR2.1TOPO
RT-PCR
    MKM21GCGTCCTTTCTATAGAATCGTA16S rRNA
    MKM22GATTAAGCTTGCTACTCTATCAGA16S rRNA
    MKM19GGTCGCTATATTGGTGAGAACTATFTT0232C
    MKM20GGAGCATACCACATAGAGACTTTFTT0232C
Real-time RT-PCR
    MKM26GAAGAGAGATTAAAGCTTGATGTTGCT16S rRNA
    MKM27GCTTGCTACTCTATCAGAAGGTTGTG16S rRNA
    MKM36pAAGCTGAAGCATGGTTAGCAAAAGGT16S rRNA
    MKM28CAAAATGCTAATGCGTCTTGCAFTT0232C
    MKM29ATTGGTAATTGCTATTTGTTGACGTTFTT0232C
    MKM37pAGGCATTGGTTTTTTAGCAAAGCCTCTACTCAAAFTT0232C
  • a Restriction endonuclease sites are underlined. p, 5′-56-6-carboxyfluorescein, 3′-36-TAMTph-labeled TaqMan probe; MCS, multicloning site.