TABLE 1.

Primers used in this study

Assay type and gene nameaPrimerOligonucleotide sequenceb
EMSA and ChIP
    Rv3857cKM1218F: GGATCCTAGCCAACCTGATACGTGCC
KM1219R: GGATCCGAGGGCACAGTTCATC
    serC-Rv0885KM1229F: GGATCCTATGCGCGTCCTGTCCATTC
KM1230R: GGATCCTGGTCGGCCATGCCATCAG
    frdAKM1260F: GGATCCGTAAACACAATCGCAGAACTGG
KM1261R: GGATCCATAACCACGATGTTGTGTTGGG
    Rv0019cKM1262F: GGATCCTCGTCCGCATGCACTGAACC
KM1263R: GGATCCGTCAGTTGCAGTACCAACC
    PE15KM1266F: GGATCCTATCTCGCTGCCGTGTAGC
KM1267R: GGATCCGGAACGACTCGCAACGTCAC
    Rv0145KM1270F: GGATCCACCTGACCGAGACCTAAC
KM1271R: GGATCCTCGCGAGGATGGTAACGAGG
    Rv0950c-sucCKM1601F: GGATCCAACTCCTTGGCTTGATACTC
KM1602R: GGATCCGAGGTGTGCGAATCGCTG
    Rv1158c-Rv1159KM1641F: GGATCCTAGCGATCGCCGAGCGCACC
KM1642R: GGATCCGCGGACAAACGTCCAGATGG
    sigA internal fragmentKM1309F: GATGACCGAGCTTAGCGAGC
KM1310R: CGTAGGTGGAGAACTTGTACC
RT-PCR
    Rv3676KM859F: ACGGCCGAGAAAACCTGTTAACC
KM860R: GACCCGCAATGCGACCTTCC
    16S rRNAKM886F: GCGAACGGGTGAGTAACACG
KM887R: TGAAAGAGGTTTACAACCCG
    Rv0145KM1272F: ATAGCTGCCGGATTCGATGG
KM1273R: GGCTCGTGGTAGGTCAACG
    frdAKM1274F: GCGATAGCCGAAACCAATCC
KM1275R: GTGAAATCCCGTCTTGTCGG
    Rv0019cKM1276F: TCATCTGGTCCGTGCTACGG
KM1277R: ATCCTAGATCTTCGACGTACC
    PE15KM1280F: CTGCCATCGAAGCAGTGACC
KM1281R: CCACCGCTGAGATACGACGC
    Rv0885KM1282F: CGAGTACGTGGAAATGCTGG
KM1283R: GAACGTGTAGTTCATCAGGC
    serCKM1286F: GGCTATGAGGTGATACTGGG
KM1287R: GGCGTCGATGACGACCAAGG
    sucCKM1288F: TTCGCCAAGCACAACGTGCC
KM1289R: TATCGCTAGCCTCAGCGACC
    sigAKM1309F: GATGACCGAGCTTAGCGAGC
KM1310R: CGTAGGTGGAGAACTTGTACC
    Rv1158cKM1643F: GGTATCGCTCACGCAGATCC
KM1644R: CGTCAGTCCTGGAAAGGTGG
    Rv0950cKM1675F: GTGCTGACCGCTCATGCATC
KM1676R: GCGTTAGCCAGGTCGATACC
    Rv1159KM1677F: CATTTTCGGTGGTCGTGTTCC
KM1678R: GCAGCAGGCCGAACAACTCG
    Rv3857cKM1679F: CTCGGATTTGATACGAAACC
KM1680R: CAGTTGCCCGAAGACGACCC
  • a The target sequence for each gene is the intergenic region for EMSA and the ChIP assay and an internal region for RT-PCR, according to the complete sequence of M. tuberculosis H37Rv on the TubercuList World Wide Web server (http://genolist.pasteur.fr/TubercuList/ ).

  • b Oligonucleotide sequences are from 5′ to 3′. F, forward primer; R, reverse primer.