Table 1.

Primers used in this study

Primer nameSequence (5′ to 3′)Use(s)Melting temp (°C)
leephage-f GATCTTCCGCCAGTTTGCCTCTCC PCR, sequencing68
leephage-r AGGTATACTGGCAATAGCGGACAC PCR, sequencing65
Mdh-a ATGAAAGTCGCAGTCCTCGGC PCR, sequencing66
Mdh-c TTACTTATTAACGAACTCTTCGCCC PCR, sequencing61
Mdh274 GTATGGATCGTTCCGACCTGTTTA Sequencing63
Mdh-r327 ATAATACCAATGCACGCTTTCGGG Sequencing63
Mdh578 TGTCACAGGTTCCTGGCGTTAG Sequencing65
Mdh-r591 CGTTTGGTCAGATCAGCCACTTCC Sequencing66