TABLE 1.

Sequences of primers used for qPCR

Gene productForward primer (5′-3′)Reverse primer (3′-5′)
HAMPCATGTTCCAGAGGCGAAGGAACGTCTTGCAGCACATCCC
TRIP4GGTTGACCACACAGGTGCAGGATCCTGGATTCGCAACTGG
LNXTCTAAAGGTCAACGGGATGGACACGCATCACAGTCAGCCAC
PKIGGATGCGACAGGCATGATGGGAGTCTCCCTGGATGTCAGGG
ELMO1ACACGTGTGGCCGTTTACGTGGCCACCTTGACGATGTC
FRDACCATCCAGTGGACCTAAGCGTTAGTGAGCTCTGCGGCCA
DUSP14CCAGCACTGCTCACTTAGGACTTCCTCCACCAAGGAATCCAAA
GAPDHGAAACTGTGGCGTGATGGGTCGCTGTTGAAGTCAGAGG
IL-8GACCACACTGCGCCAACACCTTCTCCACAACCCTCTGCAC
IL-6AATTCGGTACATCCTCGACGGGGTTGTTTTCTGCCAGTGCC
RBP1TGGAAGGTGTGGTCTGCAAGGGGATCCTGGCTCACACATC
IL1RL1TGGAAGGTGTGGTCTGCAAGGGGATCCTGGCTCACACATC