Table 2.

Oligonucleotides used in this study

OligonucleotideSequence (5′-3′)Position (5′-3′)
GW248GAAGACATTGGTTATTTGAC8342–8323 in contig C, complement strand
GW250TCCTACATGCTAAAACGGTC3152–3171 in contig C
GW251AAAATCCACAATAAAGTTAG2989–2970 in contig C, complement strand
GW254TGGGATGGGAAATCGTTCTG17646–17665 in contig C
GW273ATAAAATGAAATGTTCCACCC501–482 bp from the end of contig B (proximal to contig C)
GW278GGAAACGGTGGGAGTATCAG16324–16343 in contig C
GW280CTTTAGCAGCATTTTGGAGT1882–1901 in contig C
GW283TTTGTTTGGTTCCATCTGTC9916–9897 in contig C, complement strand
NLC94AAAGTCCAGTATGCTTTTTCACAGCTAACEnd of Tn7
NLC272ATTTTCGTATTAGCTTACGACGCTACACCCEnd of Tn7