Table 1.

Primers used for nucleotide sequence determination

PrimerOrientationCoordinate (5′ end)Sequence (5′-3′)
1F637 TGTCGGCGTTCGTTGTC
2F1997 TGGGCAGCAGATCGCTTGGG
3R2099 CTGGTGCTGGGGCTATT
4F2740 GCCAGCGCCAGGTTACTT
5R3630 GCCATTCAGTGCGGTCTT
6R4350 CCAGCCCATACGACGATA
7F4922 GGCAGGCTTTGCTGTTTC
8R5305 TGGAATGGCGGGCAGC
9F5891 CCGCTATCCGCTTTCACA
10F6314 CGTGCCGCTGTTCTGATT
11F7309 GCTGGCTACCGCTGACTT
12F7818 ACGGACTGCTGGGTAAAG
13F7863 CGTTTTTTGAGTCTCATAGA
14R7926 GCAACCCGCAGCCTCTAT
15R8732 GCGTTACTTCTGGAAGATAT
16F8965 TAAAATCAACGTGAGCATAA
17R9182 GGCTTCCCGCTCCACTCT
18R9324 CGATTTATGGCGTTGATT
19R9553 GATTTTGCAGACCTTTACCT
20F9716 GCTGTCGGCAATGGCGTT
21R10224 GGTTGGGGCAAAACCACAATTATG
22F19470 TGTTTCCCGTTGATACTA
23R20703 GCTTGTGGGCTCGTCCTC
24F28625 TCATATCTTCTCCTGTCA
25F29644 GCCGCTCATCACTTTGTT
26F30351 GCTGCTATTACCTTCTTC
27F43124 AAATCAGCCACCCACAGC
28R44277 TTGTGCGTGTTTTCTTCA
29R44841 CGTAATGACTGGGAGAGA
30F45318 GGCGAACTCATCCACATT
31F45971 GACGTTGTTGGTTTGATG
32F46775 CGGGAGAATGAAATGAAAA
33F47414 GAAACAACCGACGAAATA
34R48820 TTGTAAATCCTCAGAAGA
35R49564 CCGCCGTTGCATTGTTCT
36R50019 ATACGCCTTTTCAGATGT
37R50677 CAACGCCTTTTCCTTAT
38F50866 TATCTTCTGACGCTATGC
39F51441 CGAACTGAAAGGTGAAAG
40F52199 TTTCGCTAGGTATCACA
41F52944 TGGTCACACCGCCTTTCA
42F53624 CCCTGACGCTGTTGTGTG
43F54164 GCCGAGACAATCATCACA
44R55298 CGTAAGGCCAGCTGATGGTG
45R55755 TTTCGCGTTTCTACCACAA
46F56090 TGGTGATAGCGTCTGGTA
47F56622 GCCACTTCGACACACACC
48F57074 TGGCGTAAAGCGGAAAAC
49R58040 TCAAGTCGCGTGTTATGC
50R58552 CTGAGCATCCGGCTAACC
51R58736 TCAGGCAAGGCAATGTTTG
52R59005 CCAGCAGGAAGTTGCGGA