Table 1.

Names and nucleotide sequences of oligonucleotides used in this study

PrimeraOligodeoxynucleotide sequence (5′ to 3′)
H17TTTGACTTACTGGGGATCAAGCCTG
H19GATCATTTATTCCTCCAGATCTGGAGGAATAAAT
H28GAAGATCTCTAGGACTTGTATTGTTATAT
H34TATCAACGGTGGTATATCCAGTG
H35GCAGTTATTGGTGCCCTTAAACG
H50CCGGTGATATTCTCATTTTAGCC
8AGCGAGTATGTAGGTTCAGTA
9BGTGATACTTGAGCAATATCTTCAGC
12BCAAATCCACATAATCCACGCTGAAATC
  • a H19 was used as the adapter, and the others were used as primers for PCR amplification.