Table 3.

Positions of ORFs in contig C and features of the predicted gene products

ORFPutative RBS and start siteaPotential coding regionPredicted gene productb
Location in nucleo- tide sequence% G+CLength (amino acids)MW (103)pIGRAVY
orfde1 TTTAGGAGAGATAGTATGATT778–131440.617819.85.10−1.292
orfde2 AATAAGGAGAGTGTGTGATGAAG1558–246635.930234.09.826.762
orfde3 ACCAGGAGAGCGACGAATCAATACCAAAAATATGCCT2718–371036.333036.39.859.497
orfde4 AGTAAGGAGAAATGAGCATGCAA3831–467034.227932.35.65−2.620
orfde5 AATGGGGAAATTTTTTAACAAATGGGG4597–544537.228232.75.63−1.770
orfde5_6 AGTGAAGAAGATGAACTAATTATTTCAGATGATGGTT CTACTGATCTACCTTGGAA5577–616139.019422.29.78−1.789
orfde6 TTTAAGGAGATTGTTCATGAAA6283–714938.528832.14.82−1.719
orfde7 AATAGGAGCGAGGAAACGTGAAA7162–773438.219021.35.30−2.679
orfde8 AGTAGGAGAGTTTCAATTATGAAA7759–878738.334238.44.99−5.047
orfde9 TGTGAGATAACAGTCGAAAGGCGATGGCA8823–972238.329933.84.68−3.632
orfde10 AGTGGAAAGGTGTTTCTCTTTATGAAG9781–1050637.721126.96.230.357
orfde11 TACGGAAGGAATAAGTATATGTTT11518–1231232.626430.79.486.549
orfde12 TATAAGGAGAGAACGACATGTCA12325–1300537.722625.45.18−1.195
orfde13 TATGGAGATACGATGGAC13019–1354336.017420.24.89−3.937
orfde14 AATGGAAGGATACGACAAAAGATGAAG13533–1471436.539345.14.56−3.176
orfde15 TTTGGAAGGCGATCAGGTTTATGGTT14936–1654339.153661.05.39−4.153
orfde16 TATAAGGAGAATGCACATGAAT16700–18817 (3′ partial)
  • a Putative RBSs are underlined, and start codons are in boldface.

  • b Molecular weight (MW), isoelectric point (pI), and grand average hydropathicity (GRAVY) were calculated by using ProtParam at ExPASy. GRAVY is based on the Kyte-Doolittle formulation (24); the more negative the value is, the more hydrophilic the protein is.