TABLE 2.

Oligonucleotides used in this study

PrimerPrimer sequence (5′-3′)
eefX5′CTCACCACAAAACCAGAGG
eefX3′AAACGAGGGAATAGGTTGGG
eefA3′TTCGGTAAACAGGCGTTTCT
eefAB13′GCCTTCACTGTCTGTCCGG
eefAfin5′GACACCTACGGCGATAAATG
eefBdeb3′AGCTGAAGTAGAGCAGATGG
eefBfin5′TGACCTCGCTGGCGTTTATC
eefCdeb3′TCAGTTCGGCATCAACGGTG
eefseq1-5′AAATACATCATAGCTCCCATCG
eefseq1-3′CTCAGCACCAGCCATTTATC
eefseq2-5′CGATGCCGCCAACAAAGTTG
eefseq2-3′AAGTTCTGCAGGAACAGATAC
eefseq3-5′CGAAGGACAGCACCGAGTT
eefseq3-3′GCACGTTCATCAGGCTGTCA
RNA16S-1ATGACCAGCCACACTGGAAC
RNA16S-2CTTCCTCCCCGCTGAAAGTA
BamHIPeef5′CGGGATCCCGTATCGCGCTGCCGAATGGT
EcoRIPeef3′GGAATTCCATCTCCTCTGGTTTTGTGGT
GB5′AAAGCCACGTTGTGTCTCAA
GBnp3′TTAGAAAAACTCATCGAGCA
eefA.GB5′CCTATTCCCTCGTTTTTAAATAAACGGGGCGGACGTCTTATATCTTGAGAAAATATAATGAAAGCCACGTTGTGTCTCAA
eefA.GBnp3′TCAGAATGGCGATCACCCAGGCAAAGACCGGGCGACGCACGAAGAAACGGGAGAACATCATTAGAAAAACTCATCGAGCA
lacZ5′ATGACCATGATTACGGATTCAC
Km.lacZ3′ATCAGAGATTTTGAGACACAACGTGGCTTTATGGCCTGCCCGGTTATTAT
eefA.lacZ5′CAACCTATTCCCTCGTTTTTAAATAAACGGGGCGGACGTCTTATATCTTGAGAAAATATAATGACCATGATTACGGATTCAC
deblacZ3′TTCTCCGGCGCGTAAAAATG
aadA7ampli5′CACTGGCATTTAATAACGCGTC
aadA7ampli3′TTAATCACTTTACTTTTATC
SHV1spect5′TGTATTGTGGTTATGCGTTATATTCGCCTGTGTATTATCTCCCTGTTAGCCACCCTGCCGCACTGGCATTTAATAACGCGTC
SHV1spect3′TATCGCCCGGCACGCCTGCGAGGTGCTGCGGGCCGGATAACGCGCGCGGCCACCGCCGGGTTAATCACTTTACTTTTATC
SHV1eefA3′TGTATTGTGGTTATGCGTTATATTCGCCTGTGTATTATCTCCCTGTTAGCCACCCTGCCGAGCTGAAGTAGAGCAGATGG
spect-eefA5′TTCGGCGCAATTGACGCGTTATTAAATGCCAGTGTATCGCGCTGCCGAATGGT