TABLE 1.

M. pneumoniae genes and their oligonucleotide primers used for transcriptional analysis by RT-PCR

GenePrimer nameaPrimer sequenceAmplicon length (bp)
mpn529529RTPCRPACAACATCGAGTAAGCCATTGTC317
529RTPCRMTAGTCTGCGTATTTTCAGCGTACC
mpn530530RTPCRPGGAACCAAATAATTTAAAAGAAGAGCTAG404
530RTPCRMTCGTTTAAGTAGTCAGCTATTTTTTCAG
clpB531RTPCRP1AATTTATGAACTTTCGTTGTCTGG426
531RTPCRM2CATTTCTACAGCAGCTACCAAGGC
531RTPCRP2TTTACTAACTGAAGCAGTCCGACG544
531RTPCRM2TCTCAACTATTACGTTGTAACTAACATC
licA532RTPCRPTAGCGCGTAAAGATGTACCGTT557
532RTPCRMCAGCAACACGTAAATTACCGTTTC
ackA533RTPCRPGATTCGGTGATCGTAGATGCA558
533RTPCRMAGCGAAAACATCACGCATATCC
mpn534534RTPCRPGAATACTTTTAAAGAAACCCTCTTTTCA408
534RTPCRMACCTTTCTAATTTGCTGTTTGG
  • a P, reverse primer; M, forward primer.