TABLE 1.

PCR primers used in this work

Primer5′-3′ sequencea
GST-αF1CTAGCTAGCTCCCCTATACTAGGTTATTGGAAA
GST-αR1ATAAGAATGCGGCCGCTTATTTTATATTATAAGTTGAATTTCC
CotBF2CGCGGATCCACGGATTAGGCCGTTTGTC
CotBR1CCCAAGCTTGGATGATTGATCATCTGAAG
GST-αF2CCCAAGCTTTCCCCTATACTAGGTTATTGGAAA
GST-αR2CCGGAATTCTTATTTTATATTATAAGTTGAATTTCC
  • a Underlined residues correspond to a stop codon.