TABLE 2.

M. pneumoniae genes and their oligonucleotide primers used for RT-PCR quantification of transcripts by DNA macroarray analysisa

GenePrimer namePrimer sequenceAmplicon length (bp)Ta (°C)
dnaJ1 MPN002PAGCGGAGTATGACGCTATGCTGCGC49660
MPN002MTGTTGAGTTCGTACCACATTTGTCCAGGG
dnaJ2 MPN021PTTGCCCTATGATTTAGAGATTGCG47755
MPN021MATTGGCTACTACATTATGGTCAACC
dnaJ3 MPN119PAATAAGGCACCGGATGCGGC58957
MPN119MTAACCGTACTCAGGATTACCAATCATTGC
grpE MPN120PTTACCGAAATTCTCAGTTCCATCCG55355
MPN120MCGATACCTTCACCACCGTATTAGCCG
hrcA MPN124PACCCGACAAGCCCAAATTCTCAAGG53655
MPN124MGCGATCATTAAAGATCCTGACACATACC
tig MPN331PTTGATGCCATCTTCCAGCCG53955
MPN331MTGATCTCTAACTGCTTAATTGCTTTGAGC
lon MPN332PAGCGTTAGATAAGTTGTTGGAACGG49555
MPN332MTTTAATGTGCTCTGGATATGGG
sigA MPN352PAAGGAGAGTGATGTACCAAAGAAGCGTCG45557
MPN352MGGAAGAATCGAGCGAACCTAGAAAGAAACG
nox MPN394PTTTGGGTTGTGGAATTGCCTTGG55657
MPN394MGGTTAATGCCCGCTTTCTTCATGG
dnaK MPN434PCTACCGCCGCTGCATTGGCTTATGG44660
MPN434MAAACATCCGAAATTGGGTTGCGAGTACG
clpB MPN531PAATTTATGAACTTTCGTTGTCTGG42655
MPN531MCATTTCTACAGCAGCTACCAAGGC
groEL MPN573PGCTGTATCTACCAATGATATTGCTGG49255
MPN573MTTTCCATGCTACCTTCTAGTAACGG
groES MPN574PAGTGCCCACAAGGGAACTGTCG10355
MPN574MAAAGTAGATCGTGTCACCGATGCC
eno MPN606PAACTACGCGATGGTGATCCC55355
MPN606MGCTGCCTTAATTGCTTCGACC
ftsH MPN671PGCCTACTACCAATTATTATCTTTGTCA52355
MPN671MTTTAAGGTTTGTTCGACCACCG
  • a Reverse primers (M) were used to synthesize cDNA for hybridization. Ta, annealing temperature.