TABLE 2.

M. pneumoniae genes and their oligonucleotide primers used for RT-PCR quantification of transcripts by DNA macroarray analysisa

GenePrimer namePrimer sequenceAmplicon length (bp)Ta (°C)
dnaJ1MPN002PAGCGGAGTATGACGCTATGCTGCGC49660
MPN002MTGTTGAGTTCGTACCACATTTGTCCAGGG
dnaJ2MPN021PTTGCCCTATGATTTAGAGATTGCG47755
MPN021MATTGGCTACTACATTATGGTCAACC
dnaJ3MPN119PAATAAGGCACCGGATGCGGC58957
MPN119MTAACCGTACTCAGGATTACCAATCATTGC
grpEMPN120PTTACCGAAATTCTCAGTTCCATCCG55355
MPN120MCGATACCTTCACCACCGTATTAGCCG
hrcAMPN124PACCCGACAAGCCCAAATTCTCAAGG53655
MPN124MGCGATCATTAAAGATCCTGACACATACC
tigMPN331PTTGATGCCATCTTCCAGCCG53955
MPN331MTGATCTCTAACTGCTTAATTGCTTTGAGC
lonMPN332PAGCGTTAGATAAGTTGTTGGAACGG49555
MPN332MTTTAATGTGCTCTGGATATGGG
sigAMPN352PAAGGAGAGTGATGTACCAAAGAAGCGTCG45557
MPN352MGGAAGAATCGAGCGAACCTAGAAAGAAACG
noxMPN394PTTTGGGTTGTGGAATTGCCTTGG55657
MPN394MGGTTAATGCCCGCTTTCTTCATGG
dnaKMPN434PCTACCGCCGCTGCATTGGCTTATGG44660
MPN434MAAACATCCGAAATTGGGTTGCGAGTACG
clpBMPN531PAATTTATGAACTTTCGTTGTCTGG42655
MPN531MCATTTCTACAGCAGCTACCAAGGC
groELMPN573PGCTGTATCTACCAATGATATTGCTGG49255
MPN573MTTTCCATGCTACCTTCTAGTAACGG
groESMPN574PAGTGCCCACAAGGGAACTGTCG10355
MPN574MAAAGTAGATCGTGTCACCGATGCC
enoMPN606PAACTACGCGATGGTGATCCC55355
MPN606MGCTGCCTTAATTGCTTCGACC
ftsHMPN671PGCCTACTACCAATTATTATCTTTGTCA52355
MPN671MTTTAAGGTTTGTTCGACCACCG
  • a Reverse primers (M) were used to synthesize cDNA for hybridization. Ta, annealing temperature.