TABLE 2.

Primer sequences and predicted sizes of PCR products

PurposeGenePrimerOligonucleotide sequence (5′→3′)PCR product (bp)
CloningsesORF6GSTFCCCCGGATCCGATGAATCTAGACCTAAAATAG794
ORF6GSTRCCCCGTCGACTTATTGGGAATAAAC
setORF5GSTFCCCCGGATCCGATTCTCGTGAAGGTTTAAAAG671
ORF5GSTRCCCCGTCGACCTATTTTTCCATATATATATC
RT-PCRsesORF6FTTCAGAAATAGCCAATCATTTCAA195
ORF6RCCTTTTTGTTGAGAGCCGTC
setORF5FGGTGATTATGTAGATGCTTGGG170
ORF5RTCGGGTGTTACTTCTGTTTGC
femAfemA1AAAAAAGCACATAACAAGCG134
femA2GATAAAGAAGAAACCAGCAG