TABLE 2.

Primers and PCR conditions used in this study

PrimerNucleotide sequence (5′→3′)aPCR conditions (30 cycles)Amplicon size (bp)
DenaturingAnnealingExtension
stx2Aseq_F1TACCAGGCTCGCTTTTGCGG94°C, 30 s60°C, 45 s72°C, 80 s1,110
stx2Aseq_R2CGCCATTGCATTAACAGAAGC
stx2Aseq_F2CCATGACAACGGACAGCAG
stx2Aseq_R1CTGTATCTGCCTGAAGCGTAAGGC
stx2Bseq_FCCAGAATGTCAGATAACTGGC94°C, 30 s58°C, 45 s72°C, 30 s476
stx2Bseq_RGGCAACTGTCAACTGACTG
curli1FCGCTTAAACAGTAAATGCCG98°C, 10 s60°C, 30 s72°C, 35 s1,046
curli1RCCGCATGGTGACCAACGA
curli2FTTCCTTATGAAGCTGGGGC98°C, 10 s60°C, 30 s72°C, 35 s1,054
curli2RCGGAATCAGCCCTCCTTAC
curli3FCGCTGATGAACAACGAACG98°C, 10 s60°C, 30 s72°C, 35 s1,028
curli3RCCCGTCGCTGATTGCTGC
curli4FCTCCACACCACCGTGGAC98°C, 10 s60°C, 30 s72°C, 35 s1,047
curli4RGCTTGCAGAGCAAGTGCAG
curli5FGGCAGGTGTTGTTCCTCAG98°C, 10 s60°C, 30 s72°C, 35 s886
curli5RCCTTGAGGGTTGTGTTATCC
csgBACprom_FcgcggatccGTTGTACATTTGGTTTTTATTGCAC94°C, 15 s60°C, 30 s72°C, 60 s524
csgBACprom_RcggggtaccCAATTTGTTTTTCATGTTGTCACC
F1upCsgBAaagagctcGCACACCTGACAGCTGCC94°C, 30 s60°C, 30 s72°C, 60 s739
F1downCsgBAaaggatccTCACCCTGGACCTGGTCG
F2upCsgBAaaggatccCGCGACCGCTCATCAGTAC94°C, 30 s60°C, 30 s72°C, 60 s960
F2downCsgBAaactgcagTTCATAACGCCTCCTTACACC
CsgBAC1aaggatccGTTGCGTTAACAACCAAGTTG94°C, 30 s60°C, 30 s72°C, 90 s1,016
CsgBAC2aaggtaccGCTGATTCGCAGCAGACCA
  • a The lowercase portions of some sequences are nonmatching, and the underlined bases show the incorporation of restriction sites.