TABLE 1.

Oligonucleotide primers used in this study

OligonucleotideNucleotide sequence (5′ to 3′)aDescription and localizationb (nt position)Source or referencec
GAPA0GGCAGGACCAAGAGCTGGForward primer located upstream of the gapA gene (183-200)This study
GAPA1GGATTAGCAGTTTCTGGAGCForward primer located at the beginning of the gapA gene (457-476)This study
GAPA2TGTTCTTGTTGAACCGCTGCReverse primer located at the beginning of the gapA gene (881-861)This study
GAPA4TTCGGAAAATCCCTTTGCAGTAGForward primer located in the gapA gene (1275-1297)This study
GAPA5TAGAGGAGTAGTTGTTTGAGTTTCReverse primer located in the gapA gene (1491-1467)This study
GAPA6CTTGCAGAACCAAGAGCTCCReverse primer located at the beginning of the crmA gene (3854-3835)This study
TufG15TTCGATCGTAGTAAACCTCACGForward primer located in the tuf gene (107-128)9
TufC26GACGATTTTGAGTTGCGTATTCReverse primer located in the tuf gene (296-317)9
Tn1ACATGAATTACACGAGGGCForward primer located in the Tn4001 (2440-2458)This study
Tn2GTTCTTCTTCTGACATAGTAGReverse primer located in the Tn4001 (2840-2820)This study
IS256revGGTCATGTAAAAGTCCTCCTGGGPrimer located in the IS256 of Tn4001tag in mHAD3 (340-318 and 4694-4715)This study
IFGCCGGATTGATTTGTATGForward primer located in the gapA gene (644-661)24
IRCAGAAGTAGAAGCAGTAGGAReverse primer located in the gapA gene (1105-1086)24
JFTAAGAAGACTCCACAAATGCTForward primer located in the gapA gene (2718-2738)24
JRTAGCATCTAGCGTTCTTGCTTGReverse primer located in the crmA gene (3928-3907)24
  • a Oligonucleotides were designed based on previously published sequences.

  • b Nucleotide positions are indicated with regard to the sequence previously published (AF214004).

  • c References are indicated when primers have been previously used by others in similar studies.