TABLE 1.

Primers used in the present study

Protein fragment (residues)5′ primer3′ primer
A (MID69-186)CTTATGCTCAACAGGATCCCAGACCTACCATCAGGAAGCTTGTATATGTTG
B (MID170-377)CAAAAGTTCCTGGATCCAAAAGGACCCAAAAGCTTTTTTACGCTATTATTGC
C (MID367-590)GTGGCTAAGCGTCAGGATCCTTTTCAGTAAAGTCTGCTCGAGTTTTCTCTTAACG
D (MID567-774)CTCTGCCGCCACGGATCCAGACTTATACGGCGGCACGAAGCTTGTCGTCGTTAG
E (MID764-913)GGCGTGGATCCTGCACTACATGTTCATCAAGCTTAGAGAAGGTTTG
F (MID902-1200)CGCACGGATCCAGGCACAGCAAGCACGGTCGGGGAAGCCCAAACCAAGCTTGGC
G (MID1011-1466)CGCAACAACAGGGGATCCCAGTGAAATCGCCACAAGCTTATGACCTGCATCAAGGGG
H (MID1446-1630)CCCGGATCCCCGATGCGGACAAACTTGCCAATCCTGTAAGCTTTTTACCAGCATTGGGG
I (MID1616-2139)CAGTGAGGATCCGACTCCAACTGGTCTAAGCC TTGTCAACCCCCCCCCAAGCTTAAAGTGAAAACCTGCACC AACTGCTGCC