TABLE 1.

Oligonucleotides used for QRT-PCR and expression data comparing ORT-PCR to microarray data

ORFForward/reverse primer (5′→3′)Fold up-or down- regulationa
QRT-PCRMicroarray
BB0147 (flaB)ATGTTAGCAGCCTTGACGAGAAA/GATCGTACTTGCCGTCTTTGTTTT−0.021.54
BB0152ACTGTTGGAATTGGAACGATCAT/TTAACGCCTTTTTCAATGGCA−4.45−4.68
BB0232TTTAGATCTTTTGGTACATTTGAAGTTAGAA/AACGTGATGATCTAGGACCTTAACATACT0.021.58
BB0237AATTTGCTCCTTTAATATGCTATGATGA/TTTGACCAAGAATCGTTTGAAAAA−6.971.46
BB0240AAGTCCCGAAATACCAGGAGAAAT/TTCTTGCTGCTGTGTAAATACCAAA−0.971.75
BB0242TGTTTGGCAAGCAAATAAATCAATT/TTTACCTTTTCAAAAGGTTTAGACAGTTT−1.351.24
BB0248TTTGCTTAAAAACGAAACCGATACTA/TCAGCAAACATTGTTTGTCTAAAGAAT−10.30−2.08
BB0362TGCAGAACCATTTGACACAAATATAC/TTCTTGGAAGGTTGATTAGCAGGT−0.17−1.32
BB0469AGCGCTAAAAGTAAGCAATATTTCAAT/AACCTAATTTAACATACTTTGCAACCAA−0.064.24
BB0565AGAGGAATAAGGGAGTTAACATTTCAAA/TTCATTGACATAATCTACTAAAATTCCAAGA0.252.48
BB0690ATTTCTTTGTTATTCACAAAAAAACTCAAA/AATTCAGAATCATATCCAAGCATTCTT−1.54−1.20
BB0757ATAATGATGCTTGTGTTTTGCATGA/AAGCCTGGAAACATCCTTGGTA−1.17−1.78
BBA15 (ospA)ATGTTAGCAGCCTTGACGAGAAA/GATCGTACTTGCCGTCTTTGTTTT−18.92−5.85
BBA16 (ospB)AAATGGGAAGACAGTACTAGCACTTTAA/TGTATTGTTGTACTGTAATTGTACCATCTGTT−31.92−8.66
BBA52TCAAAAAACTCAAGACCTTCCAAAA/AATTCACTTTCTGCACCGTTAAGAT−7.09−2.78
BBA59TTGGTCGTGGGATTTTAATAGATTCTA/TGAGGCTTTTGATTGTGGGTTT−19.85−5.16
BBA62ATTATTTGTTGCTTGCGAAACTACA/TCATATCTTTATCTGTCATTGGAGCTGT−39.44−11.73
BBA65ACTGATATTTTCAATTTAGCAGAGATTGTAA/TGTTGGATTCGTATACCACCTGATATT−2.76−1.41
BBA73TTCATGGATAAAAATCGTCGATAACA/CAACCCTTATTACTTCTCCGAGAATT−11.42−2.14
BBB19 (ospC)CTGATGCAAAAGAAGCCATTTTAA/TGCTTTTGACAAGACCTCTACTGATT−0.051.61
BBE19TAAAATAGTTGCCATTTGCTCAATTAA/TTAGAAGAACTTTATATTTTTTAGACAAGAGTGTT−5.24−3.16
BBJ09 (ospD)ACAGTAGAAGCAAAAGATAAGTTAATTGATGT/TCTGCAAGCTTTGTATTGTTCGTAGT−48.23−18.77
BBK53CAAACTTTTTTTGAGAATTCGGAAA/ACGATGTTCAGACGCATATAATTTTAA−1.32−1.01
BBL40ATTACAGGGCCTGTATATGATGATTTTACT/AGCTTTCCTAATCCTTCGTCGTTA−1.50−1.03
BBR41ACAGAAAAATTACAATGGACCAATGAA/AAAGCGCACCTTCTGAAATAAGTAATA−0.55−1.40
  • a QRT-PCR or microarray data represent fold up- or down-regulation of each ORF in DMC-cultivated organisms compared to that in temperature-shifted organisms.