TABLE 1.

Oligonucleotides used for plasmid content analysis

PlasmidPrimer sequences, 5′ to 3′ (position)aPredicted fragment size (bp)Strain B31 source, genome designation, or reference
lp56 TTTCTTAAGCTGAAATCTTAGGGG(3586) 380From cloneb
TTACCAAAGAGGAGATATTTGCTC(3109)
lp56 ACTATTAAGACGAGCAATAAAAAGTCCA(42929) 596BBQ67
GACGAAGCAAAGAAGGATTTGGATCACCC(43524)
lp54 GGGAATAGGTCTAATATTAGCC(9410) 770BBA15
TTTCAACTGCTGACCCCTC(10160)
lp38 GGTCTCAATATCTTGTGTTCATG(6134) 720BBJ09
CAAGGCCACAACTTCTTGTAC(6831)
lp36 TTCTTATCCCTGACTTTCACTTTCACTTTTGAGG(7247) 381BBK11-K12
TCCTTTACTTCTATGTTTTTACTTTCCTTGGT(7627)
lp28-1 CGGGGATCCAGCCAAGTTGCTGATAAGGACGACCC 263 44
ACGGCAGTTCCAACAGAACCTGTACTATCT
AGTAGTACGACGGGGAAACCA(370) 670 70
ACTTTGCGAACTGCAGAC(1040)
lp28-1 TTCTGATGGCACTGAGCAAACCA(1309) 150BBF01
AACCCTTTACACTTTCTTCGATTGCGCT(1457)
lp28-2 CCCTCATCAAGTTTTTCCATGTGTTTTT(13824) 453BBG17
AGGTGGCCTTTCCGAGCTTGTACCTTAC(14277)
lp28-3 TAAACAAAAAAGGCCAGCGAAGCATCAA(11432) 395BBH16-H17
GCCCCCATGCAGAAAGAAACCCTATAAC(11826)
lp28-4 TCACCTCAGCTAATCTATTTATCGACAC(9005) 215BBI17-I18
AAGCGCGGAGTTTTCGGCTG(9219)
lp25 AGAATTATGTCGGTGGCGTTGT(14663) 260BBE21-E22
ATTAAAGCCGCCTTTTCCTTGGT(14899)
lp17 ACTGCAATCTGCCCAAGCTACATAATCT(7657) 283BBD12
AAGGTAAGGACGGTTGTCTACATGGATT(7939)
cp26 GGGAAAGATGGGAATACATCTGC(16971) 524BBB19
GCTTACAAGCCCTGTTGTGGCAG(17495)
cp32-1 ACGATAGGGTAATATCAAAAAAGG(21583) 471BBP33
AGTTCATCTAATAAAAATCCCGTG(22054)
cp32-2/7 GGAATGTATTAATTGATAATTCAG(20986) 370BBO32
GCGAAATAAATAGTGCCTTATGGG(21356)
cp32-3 TTACGAAAAAATAGAAAAACTAGG(21412) 328BBS35
TTTCCACTGCCCACTTTTCAGCCG(21740)
cp32-4 AGATCCTCAAAATAGTTTAACCAG(20737) 373BBR33
TTAATATTGGCAGAGAGTCTACAG(21110)
cp32-5 ACTGATAATGATGTTATGGTTAGG(3221) 365From clonec
TTTCTTAAGCTGAAATCTTAGGGG(3586)
cp32-6 GACTTTACATAGTATAAATGCTTTTGG(21008) 273BBM32
TCTCGTTATTATAAAATAAGTAGG(21281)
cp32-8 GAAGATTTAAACAAAAAAATTGCG(21376) 235BBL32-L33
GTAATCACTTCTTTTTTACCATCG(21610)
cp32-9 TATCAAAAAAGTGCTGTTTTATAG(21473) 248BBN32-N33
TAATCTCAAATATTCTTCTTTATG(21721)
cp32-11 ATTTAAGCTTACATATGCTTAACG(286) 595From cloned
CGTTGTCCTTTTCTTCCAAATTTC(881)
  • a For each primer pair, the top sequence is the forward primer and the bottom sequence is the reverse primer. Numbers in parentheses indicate the position of the 5′ nucleotide of each primer in the relevant plasmid sequence.

  • b GenBank accession number X87201 .

  • c GenBank accession number X87202 .

  • d GenBank accession number AY090888 .