TABLE 1.

Oligonucleotide primers

PurposePrimeraSequence (5′ to 3′)bLocationc5′ Tag site
sloΔ1 construction and confirmationdMF01 (F)AGCGGGATAACAATTTCACACAGGpUC18 500 to 478
MF02 (R)CGCCAGGGTTTTCCCAGTCACGpUC18 352 to 373
MF03 (R)gggggtaccGGGTCATTGACCTCAACCGTTGC slo 637 to 659 KpnI
MF04 (F)gggggtaccGAAGGTGATGATTGCAGCATAC slo 870 to 891 KpnI
MF05 (F)GCGCATTATTAGAGAGGCTATGG slo −126 to −104
MF06 (R)CAAAATTTTCAATGGTTTCACC slo 382 to 403
sagBΔ1 construction and confirmationdJJ029 (F)aaggaattcATGTCATTTTTTACAAAGGA sagB 1 to 20 EcoRI
JJ030 (R)aagttctcgagTCATTGAGACTCCTTAGTT sagB 951 to 933 XhoI
JJ055 (F)cacaagcttAACGTTAGAGATTTTG sagB 652 to 667 HindIII
JJ056 (R)gcgaagcttGTAACTACTTGAAAAA sagB 300 to 285 HindIII
JJ051 (F)ataaagcttTATACGCCAGGTAAATA sagB −239 to −223 HindIII
JJ060 (R)gagatcgatTTCAAGATTGTAGTCATC sagB 1138 to 1121 ClaI
PCR amplification of hybridization probes sagA (F)AATTGAGCTAGCCTTGTCCTTG sagA −107 to −85
sagA (R)TTTACCTGGCGTATAACTTCC sagA 159 to 139
emm5 (F)AGGCCCTTAATGAACTCTTG emm5 476 to 495
emm5 (R)CCTGCTTGTGGTGCTTGAC emm5 1217 to 1198
ska (F)TGATCGAAACGGCAAGGTCTA ska 408 to 428
ska (R)ACGGTTATGATACGGTTGGTG ska 1178 to 1158
speB (F)CTTATGCTGGTACCGCTGAGA speB 410 to 430
speB (R)TCCGCCTACTTTACCGACACC speB 1017 to 997
recA (F)TCTTCCGGTAAAACGACTGTG recA 88 to 108
recA (R)GGCGGAGCGACCTTGTTTTTA recA 656 to 636
39-M5 (F)GGTTCTGATAATACAGGACC sagA −430 to −411
40-M5 (R)GATTAATATGTAAACCCTTTC sagA −166 to −186
  • a F, forward; R, reverse.

  • b Some primers were synthesized with additional 5′ sequence tags (lowercase letters) to incorporate particular restriction endonuclease cleavage sites (underlining) (as specified in the last column).

  • c For MF001 and MF002, which correspond to pUC18 vector lacZ sequences flanking the cloned slo gene in plasmid pMK206 (42), positions indicated are relative to nucleotide 1 of the pUC18 vector sequence (62). For all other primers, positions indicated are relative to the translation start sites of the specified GAS genes, with negative numbers indicating flanking upstream sequences. GAS gene sequences were obtained from serotype M5 strain Manfredo genome sequence data published at The Sanger Centre website (www.sanger.ac.uk/Projects/S_pyogenes/ ).

  • d Only primers specified in the text are shown. Additional sequencing primers were omitted to save space.