TABLE 2.

Primers used in this study for RT-PCR and real-time PCR

PCR typeTargetPrimer sequenceaAnnealing temp (°C)No. of cyclesProduct or amplicon size (bp)
RT
b-IL-8TGCCTAAACCCCAAGGAAAAGTG AACCCTACACCAGACCCACACAGAAC53.525205
b-GROαGATTCACCTCAAGAACATCCAGAGC AGAACTGCCAAACACATTCACACC55.025396
b-GROγCAAAGAGGGAAAAGAGGAATCACC AAGGGCTGGCATAATGTGGG52.025335
b-GCP-2TTCGCCACTATGAGACTGCTATCC TCCAGACAGACTTCCCTTCCATTC60.025284
b-MCP-1AAACCAAACTCCAAAGCCTTGAG TTCTTGCGAGGACACTTCCACC52.525335
b-MCP-2ATTCTGTGTCTGCTGCTCGTGG TTCAAGGCTTCGGTGTTC55.325283
b-MIP-1αTCTGCCCTTGCCTGTTGTTC TCGGTGATGTATTCCTGGACCC55.225252
b-RANTESCCAGGAGTATTTCTACACCAGC AGCACTGAGGGTCTTTCACAGC56.525298
m-KCTGGGATTCACCTCAAGAAC AGTGTTGTCAGAAGCCAGCG53.925355
m-MIP-2CCCAGACAGAAGTCATAGCCAC AATAAGTGAACTCTCAGACAGCG55.825366
m-GCP-2GGCATTTCTGTTGCTGTTCACG CTTTCTTCTCTTCACTGGGGTCAG56.325343
m-JEGGAAAAATGGATCCACACCTTGC TCTCTTCCTCCACCACCATGCAG58.325581
m-MCP-2TGCTTCTTTGCCTGCTGCTC TGCTTGTAACATCTCTCTGCCTGG56.825358
m-MIP-1αTGACCTGGAACTGAATGC TGTGACCAACTGGAGGGATG54.425242
m-RANTESCATCCTCACTGCAGCCGCC CCAAGCTGGCTAGGACTAGAG56.225319
Real time
b-IL-8AAGTGGGTGCAGAAGGTTGTG GGAGCATGGGTTTTTCCTTTC79
b-GCP-2CCAGTGTCCCCAGGAAGCT GTCCAGGAGCCTTATGGAAGTCT103
b-GROαTTACTTTTTGTAGAGAAGATTGTCAGTTGTT CCAAGGGATATTTAGATCATTGTCATT121
b-GROγTTGGATGGCTGTTCCAGAAGTA GCCTTAGGAGGTGGTGATTCCT78
b-GAPDHTTCTGGCAAAGTGGACATCGT GCCTTGACTGTGCCGTTGA92
m-KCACCCAAACCGAAGTCATAGCC TTCAGGGTCAAGGCAAGCC60
m-MIP-2TGAGTGTGACGCCCCCA TTTTTGACCGCCCTTGAGAG71
m-GCP-2ACGCTGCGCAGCATCA GCTCCGTTGCGGCTATG59
  • a Sequences for bovine and murine chemokine genes were obtained from GenBank. Top row, primer 1; bottom row, primer 2.