TABLE 2.

Oligonucleotides used in this study

PrimerSequence (5′-3′)Amplicon size (bp)
IL-8 F GAAGGAACCATTCTCACTGTGTGTA 327
IL-8 R TTATGAATTCTCAGCCCTCTTCAAAAAC
ENA-78 F GAACCCGCGACCGCTCGC 191
ENA-78 R AGAAAAGGGGCTTCTGGATCAA
GCP-2 F CTCCACCCAGCTCAGGAACC 397
GCP-2 R GAAAAGGGGCTTCCGGGTCCA
MGSA F AGCCACACTCAAGAATGGGCG 473
MGSA R TGGCATGTTGCAGGCTCCTC
MIP-2α F ATTTGTTAATATTTCTTCGTGATGACATATCA 323
MIP-2α R TCGAAACCTCTCTGCTCTAACAC
MIP-2β F AGAACATCCAAAGTGTGAATGTAAGG 281
MIP-2β R TCCTTTCCAGCTGTCCCTAGAA
GAPDH F TCCTTGGAGGCCATGTGGGCCAT 239
GAPDH R TGATGACATCAAGAAGGTGGTGAAG