TABLE 2.

Oligonucleotides used in this study

PrimerSequence (5′-3′)Amplicon size (bp)
IL-8 FGAAGGAACCATTCTCACTGTGTGTA327
IL-8 RTTATGAATTCTCAGCCCTCTTCAAAAAC
ENA-78 FGAACCCGCGACCGCTCGC191
ENA-78 RAGAAAAGGGGCTTCTGGATCAA
GCP-2 FCTCCACCCAGCTCAGGAACC397
GCP-2 RGAAAAGGGGCTTCCGGGTCCA
MGSA FAGCCACACTCAAGAATGGGCG473
MGSA RTGGCATGTTGCAGGCTCCTC
MIP-2α FATTTGTTAATATTTCTTCGTGATGACATATCA323
MIP-2α RTCGAAACCTCTCTGCTCTAACAC
MIP-2β FAGAACATCCAAAGTGTGAATGTAAGG281
MIP-2β RTCCTTTCCAGCTGTCCCTAGAA
GAPDH FTCCTTGGAGGCCATGTGGGCCAT239
GAPDH RTGATGACATCAAGAAGGTGGTGAAG