TABLE 2.

Primers used for the mutant construction

Mutant strainPrimer and primer sequence used for mutationAmplified or deleted (Δ) region/total ORF (bp)
NameSequence (restriction enzyme)a
CMM1701Pive-1-1ggctccctatttttatttctcagc
Pive-1-2aagcttcaccatatcttgatagatcgc (HindIII)Δ481-1860/2,004
Pive-1-3aagcttaacgtcagcgaaagtgtcacc (HindIII)
Pive-1-4cgaaatcgtggtagctgttgacg
CMM1702Pive-2-1gaagatctcgatggcctaggtgtgttggg (BglII)12-631/900
Pive-2-2gctctagacgccattgccaccaacacagc (XbaI)
CMM1703Pive-3-1gaagatcttctagtgattgtgaataccagc (BglII)456-993/1,161
Pive-3-2gctctagaaacaactaagtagttattcacc (XbaI)
CMM1704Pive-4-1tggctcaggaagtaaaag120-618/726
Pive-4-2gctctagatgtaaatgctgccaaatc (XbaI)
CMM1705Pive-5-1cgacatcggtggcccaaccatg378-1,170/1,593
Pive-5-2gaagatctttgaaccagtaggccgccg (BamHI)
CMM1706Pive-6-1gctctagaccagcacgaaccattgcaac (XbaI)382-1,205/1,485
Pive-6-2gaagatctcgctgatccctcaagctgatc (BglII)
CMM1707Pive-7-1ggcttcatttcatgaagccgc
Pive-7-2aagctttccgaatagtctcacataggg (HindIII)Δ34-384/393
Pive-7-3aagcttcaataccagttcccaaaaacc (HindIII)
Pive-7-4tggatgatgaatcaagttggtcc
CMM1708Pive-8-1atgcaatcgtaaactcacagc
Pive-8-2aagcttggctttcatgtaatg (HindIII)Δ10-165/231
Pive-8-3aagcttttagaaattcctgaacac (HindIII)
Pive-8-4gctcagggcttacactttctg
CMM1709Pive-9-1gctctagaactagccagcaactcttcac (XbaI)126-685/891
Pive-9-2gaagatctacaatcgcttcatgacctga (BglII)
CMM1710Pive-10-1cgggatcctcgatatcgtcaactatag (BamHI)
Pive-10-2cgggatccttttaagttcatgtgttgg (BamHI)Δ13-291/297
Pive-10-3cgggatccgaataatgcttttgcgtg (BamHI)
Pive-10-4tacgtcggcactggcacctg
CMM1711Pive-11-1gaagatctgtaaaagttggcgttatggcg (BglII)97-710/810
Pive-11-2gaagatcttgaacgttgtcttggcgagc (BglII)
CMM1712Pive-12-1gaagatctcaagaaaacaaccactctc (BglII)106-1,197/1,410
Pive-12-2gaagatctatctaggttctctttggc (BglII)
  • a The restriction enzyme site is underlined.