TABLE 1.

Primers used to generate recombinant His-tagged proteins for use in ELISAsa

Construct5′ primer sequence3′ primer sequence
PspA31-87GGAATTCCATATGGAAGAAGCTCCCCCGGAATTCTCTCAGCTTCTTCTG
PspA31-162GGAATTCCATATGGAAGAAGCTCCCGGAATTCTAAGGAACTACTTTTGCTTGTTCC
PspA87-162GGGTTTCCATATGACTGAAGAGAAAGCAAAGCTTGGAATTCTAAGGAACTACTTTTGCTTGTTCC
PspA202-274AAAGCTGTTGAAGCCAAACAAACTCAACTCTTCAAGTTTTGATAG
PspA183-627GGGTTTCCATATGGAACCAGAACTTGCTAAAAAGTAGGGAATTCGCGCGTCGACGGCTTAAACCCATTCACCATTGG
PpmA22-313CCATGGCTAGCCACCATCACCATCACCATTCGAAAGGGTCAGAAGGTGCTCATGGATCCGGACTATTCGTTTGATGTAC
IgA1 protease671-1987CAACATCACATATGGGACAAACAGAACCAGAGACTTAGATCTTAATGATGGTGGTGATGATGGGCTTTAAAGATTGCTCTC
CbpA (P833)AGTGTAGTAGTTGCTAGTCTTGTTGGAATTCCCACATACCGTTTCTTGTTTC
  • a Primers are listed 5′→3′.