TABLE 1.

Oligonucleotide primers and reference strains used for toxin gene detection

ToxinGeneGenBank accession no.Primer(s)Sequence (5′-3′)Size of amplified product (bp)Control strain
SEA sea M18970 SEA-1GAAAAAAGTCTGAATTGCAGGGAACA560ATCC 13566
SEA-2CAAATAAATCGTAATTAACCGAAGGTTC
SEB seb M11118 SEB-1ATTCTATTAAGGACACTAAGTTAGGGA404ATCC 13566
SEB-2ATCCCGTTTCATAAGGCGAGT
SEC sec X05815 mpSEC-1GTAAAGTTACAGGTGGCAAAACTTG297ATCC 19095
mpSEC-2CATATCATACCAAAAAGTATTGCCGT
SED sed M28521 SED-1GAATTAAGTAGTACCGCGCTAAATAATATG492FRI-1151m
SED-2GCTGTATTTTTCCTCCGAGAGT
SEE see M21319 SEE-1CAAAGAAATGCTTTAAGCAATCTTAGGC482ATCC 27664
SEE-2CACCTTACCGCCAAAGCTG
SEG seg AF064773 SEG-1AATTATGTGAATGCTCAACCCGATC642A900322
SEG-2AAACTTATATGGAACAAAAGGTACTAGTTC
SEH seh U11702 SEH-1CAATCACATCATATGCGAAAGCAG376ATCC 51811
SEH-2CATCTACCCAAACATTAGCACC
SEI sei AF064774 SEI-1CTCAAGGTGATATTGGTGTAGG576A900322
SEI-2AAAAAACTTACAGGCAGTCCATCTC
SEJ sej AF053140 mpSEJ-1TAACCTCAGACATATATACTTCTTTAACG300FRI-1151m
mpSEJ-2AGTATCATAAAGTTGATTGTTTTCATGCAG
SEN sen AF285760 mpSEN-1ATGAGATTGTTCTACATAGCTGCAAT680A900322
mpSEN-2AACTCTGCTCCCACTGAAC
SEO seo AF285760 mpSEO-1AGTTTGTGTAAGAAGTCAAGTGTAGA180A900322
mpSEO-2ATCTTTAAATTCAGCAGATATTCCATCTAAC
SEM sem AF285760 mpSEM-1CTATTAATCTTTGGGTTAATGGAGAAC300A900322
mpSEM-2TTCAGTTTCGACAGTTTTGTTGTCAT
TSST-1 tst J02615 TST-1TTCACTATTTGTAAAAGTGTCAGACCCACT180FRI-1169
TST-2TACTAATGAATTTTTTTATCGTAAGCCCTT
ETA eta M17347 mpETA-1ACTGTAGGAGCTAGTGCATTTGT190TC-7
mpETA-3TGGATACTTTTGTCTATCTTTTTCATCAAC
ETB etb M17348 mpETB-1CAGATAAAGAGCTTTATACACACATTAC612TC-146
mpETB-2AGTGAACTTATCTTTCTATTGAAAAACACTC
PVL components lukS-PV– AB006796 PVL-1ATCATTAGGTAAAATGTCTGGACATGATCCA433ATCC 49775
  S and F  lukF-PVNPVL-2GCATCAASTGTATTGGATAGCAAAAGC
LukE-LukD lukE-lukD Y13225 LUKDE-1TGAAAAAGGTTCAAAGTTGATACGAG269FRI-913
LUKDE-2TGTATTCGATAGCAAAAGCAGTGCA
LukM lukM D42144 LUKM-1TGGATGTTACCTATGCAACCTAC780ATCC 31890
LUKM-2GTTCGTTTCCATATAATGAATCACTAC
Alpha-hemolysin hla M90536 HLA-1CTGATTACTATCCAAGAAATTCGATTG209FRI-913
HLA-2CTTTCCAGCCTACTTTTTTATCAGT
Beta-hemolysin hlb S72497 HLB-1GTGCACTTACTGACAATAGTGC309NCTC 7428
HLB-2-2GTTGATGAGTAGCTACCTTCAGT
Delta-hemolysin hld AF288215 HLD-1AAGAATTTTTATCTTAATTAAGGAAGGAGTG111NCTC 9393
HLD-2TTAGTGAATTTGTTCACTGTGTCGA
Gamma-hemolysin hlg L01055 mpHLG-1GTCAYAGAGTCCATAATGCATTTAA535ATCC 49775
  components A, B, and CmpHLG-2CACCAAATGTATAGCCTAAAGTG
Gamma-hemolysin hlg-2 D42143 mpHLG2-1GACATAGAGTCCATAATGCATTYGT390RIMD 31092
  variantmpHLG2-2ATAGTCATTAGGATTAGGTTTCACAAAG
EDIN edin M63917 EDIN-1GAAGTATCTAATACTTCTTTAGCAGC625E-1
EDIN-2TCATTTGACAATTCTACACTTCCAAC