TABLE 1.

Oligonucleotide primers and reference strains used for toxin gene detection

ToxinGeneGenBank accession no.Primer(s)Sequence (5′-3′)Size of amplified product (bp)Control strain
SEAseaM18970SEA-1GAAAAAAGTCTGAATTGCAGGGAACA560ATCC 13566
SEA-2CAAATAAATCGTAATTAACCGAAGGTTC
SEBsebM11118SEB-1ATTCTATTAAGGACACTAAGTTAGGGA404ATCC 13566
SEB-2ATCCCGTTTCATAAGGCGAGT
SECsecX05815mpSEC-1GTAAAGTTACAGGTGGCAAAACTTG297ATCC 19095
mpSEC-2CATATCATACCAAAAAGTATTGCCGT
SEDsedM28521SED-1GAATTAAGTAGTACCGCGCTAAATAATATG492FRI-1151m
SED-2GCTGTATTTTTCCTCCGAGAGT
SEEseeM21319SEE-1CAAAGAAATGCTTTAAGCAATCTTAGGC482ATCC 27664
SEE-2CACCTTACCGCCAAAGCTG
SEGsegAF064773SEG-1AATTATGTGAATGCTCAACCCGATC642A900322
SEG-2AAACTTATATGGAACAAAAGGTACTAGTTC
SEHsehU11702SEH-1CAATCACATCATATGCGAAAGCAG376ATCC 51811
SEH-2CATCTACCCAAACATTAGCACC
SEIseiAF064774SEI-1CTCAAGGTGATATTGGTGTAGG576A900322
SEI-2AAAAAACTTACAGGCAGTCCATCTC
SEJsejAF053140mpSEJ-1TAACCTCAGACATATATACTTCTTTAACG300FRI-1151m
mpSEJ-2AGTATCATAAAGTTGATTGTTTTCATGCAG
SENsenAF285760mpSEN-1ATGAGATTGTTCTACATAGCTGCAAT680A900322
mpSEN-2AACTCTGCTCCCACTGAAC
SEOseoAF285760mpSEO-1AGTTTGTGTAAGAAGTCAAGTGTAGA180A900322
mpSEO-2ATCTTTAAATTCAGCAGATATTCCATCTAAC
SEMsemAF285760mpSEM-1CTATTAATCTTTGGGTTAATGGAGAAC300A900322
mpSEM-2TTCAGTTTCGACAGTTTTGTTGTCAT
TSST-1tstJ02615TST-1TTCACTATTTGTAAAAGTGTCAGACCCACT180FRI-1169
TST-2TACTAATGAATTTTTTTATCGTAAGCCCTT
ETAetaM17347mpETA-1ACTGTAGGAGCTAGTGCATTTGT190TC-7
mpETA-3TGGATACTTTTGTCTATCTTTTTCATCAAC
ETBetbM17348mpETB-1CAGATAAAGAGCTTTATACACACATTAC612TC-146
mpETB-2AGTGAACTTATCTTTCTATTGAAAAACACTC
PVL componentslukS-PV–AB006796PVL-1ATCATTAGGTAAAATGTCTGGACATGATCCA433ATCC 49775
  S and F  lukF-PVNPVL-2GCATCAASTGTATTGGATAGCAAAAGC
LukE-LukDlukE-lukDY13225LUKDE-1TGAAAAAGGTTCAAAGTTGATACGAG269FRI-913
LUKDE-2TGTATTCGATAGCAAAAGCAGTGCA
LukMlukMD42144LUKM-1TGGATGTTACCTATGCAACCTAC780ATCC 31890
LUKM-2GTTCGTTTCCATATAATGAATCACTAC
Alpha-hemolysinhlaM90536HLA-1CTGATTACTATCCAAGAAATTCGATTG209FRI-913
HLA-2CTTTCCAGCCTACTTTTTTATCAGT
Beta-hemolysinhlbS72497HLB-1GTGCACTTACTGACAATAGTGC309NCTC 7428
HLB-2-2GTTGATGAGTAGCTACCTTCAGT
Delta-hemolysinhldAF288215HLD-1AAGAATTTTTATCTTAATTAAGGAAGGAGTG111NCTC 9393
HLD-2TTAGTGAATTTGTTCACTGTGTCGA
Gamma-hemolysinhlgL01055mpHLG-1GTCAYAGAGTCCATAATGCATTTAA535ATCC 49775
  components A, B, and CmpHLG-2CACCAAATGTATAGCCTAAAGTG
Gamma-hemolysinhlg-2D42143mpHLG2-1GACATAGAGTCCATAATGCATTYGT390RIMD 31092
  variantmpHLG2-2ATAGTCATTAGGATTAGGTTTCACAAAG
EDINedinM63917EDIN-1GAAGTATCTAATACTTCTTTAGCAGC625E-1
EDIN-2TCATTTGACAATTCTACACTTCCAAC