TABLE 1

Oligonucleotide primers and fluorescent probes used for TaqMan RT-PCR

Accession no.DesignationaForward primer (5′-3′)Reverse primer (5′-3′)Fluorescent probeb (5′-3′)
AF057697 sof49 (SOF) CACTACAAAGACGATTGGTGCTAAA CAACACCCCAGTCCCAATCT TAGAGGAAGTTTGGGAGCAGGCCAAAA
M31789 emm49 (M49) GCATCCGTAGCGGTCGC CAGCAGCCTTAACTTCTGTTTGG TGGCTGTTTTAGGAGCAGGCTTTGCA
X68501 mga49 (Mga) GCTCAATCTCAGCATCACCAATAA AATGTCTTCTTCGTCTAACACCGA ACGAAGTTGCCGTAACCCTCCATAACG
X72753 enn (Enn) AGCACCAAAAATTAGAGGCTGATC GATGCTTCAAGGTCACGGCT CCAAGTTTCAGAGACTAGCCGCAAGGG
X78055 scpA49 (C5a peptidase) AAACGAAAGAACCTTACCGCC CGACACGCATCAAAAGCAA AGAAGGTGCGATGCCTGAGGCTCA
X80397 orfX (OrfX) TCTACTGAGTCTACTACTCAGCCAGTTGA TGTCACCATCGAATCTGAAGCT CACCCGTGCAGGAGACACAGGC
SPy0167 slo (SLO) GAAATATCCGTATCATGGCTAGAGAGT CACATCTCTTTCGTCGATCACTTT GCCACCATTCCCAAGCTAAGCCAGTG
SpyO212 speG (SpeG) TTCTATTGTATCTTTAGGCATTACTGATCA TTCGAATGTTTTACAATACCACCATAA CGATGTTTTTGGTCTCCCTTATAATTTTTCCCC
SPy0242 fasB (FasB) TGAGCCGTATAGAGCGTTTAGGT TCATGAACCGTTTGGGCATA AAGCCATTAAGAGTGAATCCATTACTCAGATTCAAGA
SPy0244 fasC (FasC) CACAAAAACCAATCGTGTGGATA CAGTCAAAAAGTGGGCTGAGTTC AGCCAAACGCTTTGATGCTCAGCAG
SPy0245 fasA (FasA) CGTTGTGGGCTTGAATTAGCT ATTCTGAATGAGTGGTGACAAACAC CAGCTATTCGACAAAAAGATCCTAATGCCGTTAT
SPy0336 csrR (CsrR) GGTGCAGACGACTATATTGTTAAACCC TTGACGGCGGAAAATAGCA TTTGCCATTGAAGAACTACTTGCCCGTATTC
SPy0337 csrS (CsrS) CCTGGCTTGCATGGTCCTA CATGGAAAACCCACGATACTGA CGGTCGTGTGTATCACGACCATATCGA
SPy0528 vicR (VicR) ACGTGACCAAGCCCTTTTCTAA TTCGGTACGACGCAGATGAG CACGCGCCAGCAATTCCCG
SPy0529 vicK (VicK) GCGCTTTGCGTTGAATAGG TCCTGTTCTGTGGTGTCATGGA CCACAACCAAGCCCGAAATAAAACCACT
SPy0738 sagA (SLS) TTGCTCCTGGAGGCTGCT CTTCCGCTACCACCTTGAGAAT ACCACTTCCAGTAGCAATTGAGAAGCAACAAG
SPy0747None (none) TTGTGTGCAACCAGTCACTTTTAA TCTTTCGCAAATTGTGCTAGCA TCTGAGCAAAGACGTCACGTCTTGGCTA
SPy0861 mac (Mac) ACTTCCGTTTGGACCAAAGGA CAACATAAGGAGCGTGAAAAACATC TTACTCCTCCAGCAAACTTCACTCAAGGTGA
SPy0874 trcR (TrcR) TGGCAGATGTCTAATGTTTTGACA TGCCTCTTGACCGTTAAAAACC CTGCCATGACTCATCAAGGTTATGACGTTG
SPy0875None (none) TTCCGGTATGGTCATCAAACC ACTCGTGGCCTGCATTAGTAATAA GCGACGCTGCTTCTCAGAATTTTGGACA
SPy0895 deoD2 (DeoD2) TTGCCTTTCTAGCGGAACATG GCGATTGGTTAAGCCATAATGAAC CAGAGAATCGGACCATTGAAGACCAGTATCAC
SPy0898 cpsY (CpsY) CACAACTCCTTTTATTTTTCAGAAGAGA GCACGGTCACTGACCACAAT ATGTCCCAGATGCCCCACAACAAATC
SPy1008 speH (SpeH) TCACAGGAATTCAAAGATAAAGAAGTAGA CAAACGCTTCATACCTTTTCCC ATTTATGCTCTATCTGCACAAGAGGTTTGTGAATGT
SPy1061 yesN (YesN) GTTATCATTGTTGCTAATTGGTCTTTTTAT GGTTGCAGTGGCATTGATATCA TCATTAGCGCCACAACAATTAGGCCTCTATC
SPy1062 yesM (YesM) TTGGAGTGGGTACATGCTCATT AACTCTCACTATACCCTAAGTCATGAGCTA TCAAGACAAGATCAGCACGAGCCGC
SPy1106 yufM (YufM) GCAATGGGATTCAATTTTTGGA ATTTGCGGCTGAAATAATAATGACT AAATGGCGTACTCAGCATATTCCTTGCG
SPy1236 ciaS (CiaS) GGTCCAGGGATAACAGATGAAGAA CCACCTGTTTGCCGTGTTC AGCTTGTCAACTCGATAAAAACGATCAAAAATCTTT
SPy1237 ciaR (CiaR) GATCATGACAGCTAAAGAGGGTTTAGA AATAGAACGGCTTTGTCAGATAATCA CAGCACCTAATTCAAATCCGTGGCCTT
SPy1357 grab (Grab) GCATCAGTATTAGTCGGTTCAACAGT CCGCCATTTGGAATAATTCG TCTGCTGTTGACTCACCTATCGAACAGCC
SPy1436 mf-3 (MF-3) TCCTCCTGGCTGGCATAATT CTAAATGGCCACGGTCCATT AAATTGACTGACGCTAATGGAAAAACAACTTGG
SPy1556 zmpS (ZmpS) AAAAGAAGTATCAGCAATAGCAATGG TGCTGAGCCAAGCTTTTTAGG TCAAATCAGAATCTGCCAACCGCTCA
SPy1587 lytR (LytR) GATTTTACAAGGGCTCACCATGA TGCCTGATCTTGCTGTTTGAA ACTTCAAATCCAAGTGCCTGCCAATCA
SPy1588 lytS (LytS) TTTACCTCCGTCTCTTTCATCATTT AAGCCACCATTTGGCTCCTT CGAGACAGGGTTTCTTGGTCCATGGC
SPy1801 isp-2 (Isp-2) CGTCGCGCACAAATTATGG GGCTGGAATGGCTGGTGT CCATGGTCATCAATCCACTTATCCAGGTCT
SPy1908 salR (SalR) TTGATGACCACAGACTATTTGCAA ACATCGTTAAAATGAGAAGTAATCGTATCT CCAACTGTTATTCCAACAGTATGATGAAGTAGATGTCA
SPy1909 salK (SalK) GGATTGTACTCATGAAGGTATTAGTTAAAGA TTGGAGTTTTCTAAATAATAAAAGATGCA GAAATTACCACTAGACAAAACAACGTGCTTGCGT
SPy1979 ska (SKA) TGCTGACAAAGATGGTTCGG GCACATGTCCCTTTAACAAAAATTC ACCTTGCCGACCCAACCTGTCCA
SPy1983 scl1 (Scl-1) CAAACTAGTCTGGCGCTACGG TTGCCCCGCCTCCAA CCTCAGCCGCTGCCGTCCTTCT
SPy2025 isp-1 (Isp-1) GCAGCGCAAGCCAGGTT CTTGGCCTGGTGCAAATGA ACCACCCATAAACCTAAAGTGGGCTA
SPy2026 ihk (Ihk) GGTGACTTTGCAGATCGTGACA TTGAACCAGTTGGGCTTGC AAGGACGTCTCGGCACTTTCGCAAATAT
SPy2027 irr (Irr) TCGAAAATGTATTACGCGTCTCTACT CGCTATGTTCGGTCTCATCAAC CAGATGAAAAGCGCCAAATCGGAGACTTAC
SPy2043 mf-1 (MF-1) CCCAAAATGTAGGAGGTCGTG CATTCTTGAGCTCTTTGTTCGGT CCAAAAAGGCGGCATGCGCT
SPy2200 hasA (HasA) ACCGTTCCCTTGTCAATAAAGG CGTCAGCGTCAGATCTTTCAAA CGCCATGCTCAAGCGTGGGC
SPy2201 hasB (HasB) GAATCGAGAAAATTAAATAGTCACATGATT CCTCCATAACCAAATGATGGGT TTCAAGGAATTTCTTATGATGATCGAATAGGAATGC
SPy2202 hasC (HasC) TGAAACCACTGCCATTAACCTTC GCTTGTAAGACAGCATCTCCCA TTTTATCCGTCAAAGCCACCCAAGAGG
  • a Gene designations are shown in italics, and the corresponding protein designations are in parentheses.

  • b Covalently linked at the 5′ end to 5-carboxyfluorescein and at the 3′ end to N,N,N-tetramethyl-6-carboxyrhodamine.