TABLE 1.

Oligonucleotide primer pairs used in RT-PCR of Fcs1, Fcs2, and Fcs3, analysis of the adjacent Hif cap DNA, and as probes in Southern blot hybridization

Oligonucleotide nameSequence (5′-3′)Gene(s) (size [bp])Reference
f1GCTACTATCCAAGTCCAAATCHif cap specific (450)5
f2CGCAATTATGGAAGAAAGCT5
HI-1CGTTTGTATGATGTTGATCCAGACbexA (343)5
HI-2TGTCCATGTCTTCAAAATGATG5
ORF6GTTATTACTTGCGTGATCGThcsB (311)24
Reg3bGCAATGGCACATCATGCACThis study
Fcs1-aCGTGACGCATTGAATAATAAATACfcs1 (720)This study
Fcs1-bCTGTGCCTTAGCATTTGCGGAGThis study
Fcs2-aGTTAATGCAAAAGATCAAGfcs2 (1,149)This study
Fcs2-bCATAGTTATACCATGCTGTAACCThis study
Fcs3-aCCGGGAATCCATAGAGTTCAfcs3 (992)This study
Fcs3-bGAGCATTCTATAATATGCAATGGThis study
Fcs1-2-aCGCTCCGCAAATGCTAAfcs1-fcs2 (323)This study
Fcs1-2-bTTCTTCACTGTTATCAGGGCTACThis study
Fcs2-3-aCGATGAATTATCTCTATCTTACAAGGfcs2-fcs3 (417)This study
Fcs2-3-bCTGATGGTGTATGAACTCTATGThis study
capfSodCCATGCGCATTTTCCACGCCAGCbexA-sodC (875)This study
capfBexAGGGATTGAGGCGCAATGATTCGThis study
capfMerTCCTTTTGGGTTGCCATAGCCmerT-sodC (774)This study
SodC 3970-2951CACTCAGATCATCCTGCTCCThis study
capf region IIICAGTACGAGTGGTATTTCAGhcsB-HI1637 (700)This study
HI1637AAATTTCCATTATGGGAAACGThis study