TABLE 2.

Nucleotide primers used in this study

PrimerSequence (5′-3′)a
Kat2RbTGAGTACTGACCAACCTGAGAAAAGGA
Kat2FbTGAGTACTAAAAAACGCCCACTGAAAC
pG3EmRTGACTGCGCTTACCCTTCCT
pG3EmFAGGCAGGAGAGGGATTCGTC
ccpRcACGCGTCGACCTCCCATAAGGAATACACG
ccpFcACGCGTCGACAGCCGATGGTAATGGTAGC
mntRcACGCGTCGACACAGGAAAACAGTTATGAAAC
mntFcACGCGTCGACTGAATGTAAACCGGTGAGG
msrRcACGCGTCGACCGTCCACACAGGAAACATC
msrFcACGCGTCGACGCGATGCTGTCTGAACAAATC
  • a Enzyme restriction sites (underlined) were included in these primers for cloning purposes.

  • b Primer contains a ScaI restriction site.

  • c Primer contains a SalII restriction site.