TABLE 1.

The PhoP-PhoS homologs identified in E. faecalis V583 and outcome of disruption in E. faecalis OG1RF

Locus nameE value (R/S)DirectionaOligonucleotidesbDisruption outcomecBest hit (R/S)d
102765e-75/4e-05R→S5′ TTGGAAAAAGAAGGCTATCViableResponse regulator of Listeria innocua/sensor kinase of Listeria monocytogenes; NP_471974/NP_466023
5′ ACGTAAATGTCTAATGTGGAC
102993e-68/2e-26R→S5′ AAAATGGATGGCTTAGAANot recoveredVicR/VicK of Enterococcus faecalis; CAB64972/CAB64973
5′ AAATACGTTGGATGACTTG
102759e-49/3e-19R→S5′ ATGATGATAAAGAAATTGTAGAACViableResponse regulator/histidine kinase of Lactobacillus sakei; AAD10265/AAD10266
5′ CACACGATTTGGATGACT
102922e-46/1e-20R→S5′ TAAAGATGATGGTAAAGAAGGViableResponse regulator/histidine kinase of Lactobacillus sakei; AAD10267/AAD10268
5′ ATATGGGCATCAACTGTC
102931e-41/2e-82R→S5′ AGATGAAAAGAACTTAGCGAGATTViableLisR of Listeria monocytogenes/sensor kinase of Lactococcus lactis; AAF03932/NP_267749
5′ CGTTCACGTTTTCCATTAGC
10321e5e-41/1e-11R→SNANAVanRB/VanSB of Enterococcus faecalis; Q47744/Q47745
103033e-38/2e-25S→R5′ TGCCCAAAAAGAAAATCCATViableResponse regulator/histidine kinase of Clostridium acetobutylicum; NP_346962/NP_346958
5′ AAGCGTTCGAATAAATAAGGTAAT
10288f2e-37/6e-10S→R5′ TTAATAAAACTGCTGAACCANAResponse regulator/sensor kinase of Listeria innocua; NP_472154/NP_472155
5′ TCCATTTTACCATTGTGC
372004e-30/8e-25S→R5′ AAATATGAAGCTAATCGGAAAGAAViableResponse regulator/histidine kinase of Clostridium acetobutylicum; NP_346962/NP_346958
5′ AAGCGTTCGAATAAATAAGGTAAT
102986e-27/5e-07R→S5′ CGAGAATTAATTAGCGAGGAAViableResponse regulator/histidine kinase of Lactobacillus sakei; AAD10258/AAD10259
5′ CCGTCAGCGTATTGTCATC
10285f2e-26/3e-06R→SCould not amplifyNAResponse regulator VncR/sensor kinase VncS of Streptococcus pneumoniae; NP_345115/NP_345116
  • a Direction of transcription. In all cases, the gene on the left was disrupted. R, response regulator; S, sensor kinase.

  • b Oligonucleotides used to amplify the gene on the left. NA, not attempted.

  • c The outcome of gene disruption.

  • d The GenBank accession numbers are given.

  • e The vancomycin resistance regulatory system VanRBSB.

  • f PCR product not obtained from OG1RF.