TABLE 3.

Oligonucleotide primers used for characterization of stx2e-flanking regions

Primer designationPrimer sequence (5′-3′)
2771-218AGTGATGATGACGGACTG
stx2-10CACTTTTCACGCAACCATAAC
stx2-9AGGTATTTCTATGGGCGG
2771-111GCCAGACCCGCCATAAC
2771-83GAACGCTTTAACGTGCTG
2771-109CGAAGAAAAACCCAGTAACAG
stx2-4CAAAAAGCGGCACAGGAC
stx2-5CCCTTTGCCGCATAGCC
2771-metstartATGGCTAACACTGTAAAAATA
stx2-1CCCCATGAAAAAATCTGCAAC
2771-108CCTTCTAAGCAATCGGTC
2771-107GATGGCAATTCAGTATAACGG
2771-106GAGTCAACCAGAATGTCAG
2771-97CCTGCTTAAATGCCTGTG
2771-102CTTAACATTGCCGCCTCC
stx2-8CAGGGTTTGACAGTGGG
2771-endostopTCACCACTTCAACTGAAAGTG