TABLE 2.

Oligonucleotide primers used in this study

PrimerSequence (5′ to 3′)a
T1AACGGGAAAGGTTCCGTC
T2CTTGCACAGATAGCGTGG
T3TGTAGCGGATGGAGATCG
T4ATGGAAGTCAGATCCTGG
pKD4FTGTGTAGGCTGGAGCTGCTTC
pKD4RCATATGAATATCCTCCTTAG
pstCAFTTCGTTCAGCGTCTGCC
pstCARAGTTCGGTGATCAGCTCTTC
pstCAKanFCTAAGGAGGATATTCATATGATTACCCTGTGC
pstCAKanRGAAGCAGCTCCAGCCTACACAAGGCTTGGTTGC
pstCAISceIF TAGGGATAACAGGGTAATTTCGTTCAGCGTCTGCC
pstCAISceIR TAGGGATAACAGGGTAATAGTTCGGTGATCAGCTC
pstCAcFACTTTGTAAACGCGTTTAAACTG
pst4′TGTTAACCGTGTTTATTCTTCG
phoBFACGGTAGTATTGAGGAACG
phoBRAGGTAACCCTGTAACACG
phoBKanFCTAAGGAGGATATTCATATGACGGTCGATGTC
phoBKanRGAAGCAGCTCCAGCCTACACATTCTACGACCAG
phoBISceIF TAGGGATAACAGGGTAATACGGTAGTATTGAGG
phoBISceIR TAGGGATAACAGGGTAATAGGTAACCCTGTAAC
CrpstCAcFTACGTTAGTCTGGAAGCACG
CrpstCAcRTTAGCCGTGTTTCTTCTTAGC
ICC169phoB-FRTTCCTCGACTGGATGTTGCCb
ICC169phoB-RRTTCTGGCGGTAAGCATCACCb
phoB-FRTATGACAGTGCTGTGAATCAAc
phoB-RRTTCAACATCACCACTGGAATAc
rpoD-FRTTGATCATGAAGCTCTGCGTTGAd
rpoD-RRTTCTCAGACCACGGTTTGTTCATd
ler-FRTACTACCGTAATGAAGACGGACAe
ler-RRTTGCTTCTTTAAGCCAACGTGe
eae-FRTTATCCTGCATTAGGTGGCAAf
eae-RRTGTCACCAAAGGAATCGGAGTf
  • a Underlined nucleotide sequences are homologous to the flanking regions of the pstCA and phoB genes, and restriction sites for I-SceI are shown in boldface.

  • b Primers used for RT-PCR of ICC169 phoB.

  • c Primers used for RT-PCR of E128012 phoB.

  • d Primers used for RT-PCR of the housekeeping gene rpoD.

  • e Primers used for RT-PCR of ICC169 ler.

  • f Primers used for RT-PCR of ICC169 eae.