TABLE 1.

Sequences of primers and bacterial strains used in this study

ToxinStrainReference or sourceStrain and plasmid use for productionPrimersa
SEAA87 0502This studyS. aureus RN6390GAAGGCCTAA AAAAACAGCA TTTACATTAC TTTTATTCAT TG
pLUG 345CGCGGATCCG TTATTAATGA TGATGATGAT GATGAGAACC CCCACTTGTA TATAAATATA TATCAATATG CATGTTTTC
SEBCOL12S. aureus RN6390GAAGGCCTTA TAAGAGATTA TTTATTTCAC ATGTAATTTT G
pLUG 345CGCGGATCCG TTATTAATGA TGATGATGAT GATGAGAACC CCCCTTTTTC TTTGTCGTAA GATAAAC
SECFRI 137This studyE. coli M15GTAGGATCCG AGAGCCAACC AGACC
pQE30GGACTGCAGT TATCCATTCT TTGTTGTAAG GTGG
SEDFRI 137This studyE. coli M15GTTGGATCCA ATGAAAACAT TGATTCAGTA AAAGAG
pQE30TTGCTGCAGC TACTTTTCAT ATAAATAGAT GTCAATATG
SEEFRI9187E. coli M15CGCGGATCCA AAAAAACAGC ATTTATACTA CTTTTATTCA TTGC
pQE30CCCAAGCTTA GTTGTGTATA AATACAAATC AATATGGAGG
SEGA99 0372This studyS. aureus RN6390GAAGGCCTAA GAAATTATCT ACTGTAATTA TTATTTTGAT TCTAGAAATA G
pLUG 345GGAAAGATCT TTTATTAATG ATGATGATGA TGATGAGAAC CCCCGTGAGT ATTAAGAAAT ACTTCC
SEHMW21E. coli M15TCAGGATCCAAAGCAGAAG ATTTACACGA TAAAAG
pQE30TTTCTGCAGT TATACTTTTT TCTTAGTATA TAGATTTACA TC
SEIA90032218S. aureus RN6390GAAGGCCTAA AAAATTTAAA TATAGTTTTA TATTAGTTTT TATATTACTT TTTAACATTA AAG
pLUG 345CGCGGATCCG TTATTAATGA TGATGATGATGAT GAGAACCCCC GTTACTATCT ACATATGATA TTTCGAC
SEJFukuoka 545E. coli M15TACGGATCCA GCAAAAATGA AACAATTAAA GAAAAGAATT TGCAC
pQE30TTACTGCAGC TACAGAACCA AAGGTAGACT TATTAATAC
SElKHT2003 0702This studyE. coli M15CGCGGATCCA AAAAATTAAT AAGCATCTTA TTAATAAATA TAATAATTTT AGGTG
pQE30CCCAAGCTTT ATCGTTTCTT TATAAGAAAT ATCGACATC
SElLHT2003 0702This studyS. aureus RN6390GAAGGCCTAA AAAAAGATTA TTATTTGTAA TTGTTATTAC TTTATTTATTTTTTCTTC
pLUG 345GGAAAGATCT TTTATTAATG ATGATGATGA TGATGAGAAC CCCCTCTTTTTGAAATTTCG ACATCTAGAT GAAATT
SElMA90032218S. aureus RN6390GAAGGCCTAA AAGAATACTT ATCATTGTTG TTTTATTGTT TTG
pLUG 345CGCGGATCCG TTATTAATGA TGATGATGAT GATGAGAACC CCCACTTTCG TCCTTATAAGA TATTTCGA
SElNA90032218E. coli M15GAAGGCCTAG ATTGTTCTAC ATAGCTGCAA TTATAATAAC
pQE30CGCGGATCCG TTATTAATGA TGATGATGAT GATGAGAACC CCCATCTTTA TATAAAAATA CATCAATATG ATAATTAG
SElOA90032218S. aureus RN6390GAAGGCCTAT TAAAAATAGT AAAGTAATGT TAAATGTATT ATTAATTTTA AATTTAATTG
pLUG 345CGCGGATCCG TTATTAATGA TGATGATGAT GATGAGAACC CCCTGTAAAT AAATAAACAT CAATATGATA GTCTG
SElPHT2003 0702This studyS. aureus RN6390GAAGGCCTAG TAAAATAAAA AAAACAACAT TTATACTACT TTCATTTATT G
pLUG 345GGAAAGATCT TTTATTAATG ATGATGATGA TGATGAGAAC CCCCAGTTGT ATATAAATAT ATATCAATAT GCATATTTTT AGAC
SElQCOL12E. coli M15GCAGGATCCGATGTAGGGG TAATCAATCT TA
pQE30AAACTGCAGT TATTCAGTTT TCTCATATGA AATCTC
SERFukuoka531E. coli M15GTAGGATCCAAACCAGATC CAAGGCCTG
pQE30CCGCTGCAGT CACATTGTAG TCAGGTGAAC TTC
SElUA94062442E. coli M15CA GGATCC ATG TTA AAT GGC AAT CCT AAA C CA
pQE30GC CTGCAG TTA TTT TTT GGT TAA ATG AAC TTC TAC ATT AAT AGA TTT A
SElVA94062442E. coli M15GCA GGATCC GAT GTC GGA GTT TTG AAT CTT AGG
pQE30TAA CTGCAG TTA GTT ACT ATC TAC ATA TGA TAT TTC GAC ATC
TSST-1N315Kuroda, 2001S. aureus RN6390GAAGGCCTAATAAAAAATTACTAATGAATTTTTTTATCGTAAGCCC
pLUG 345GGAAAGATCTTTTATTAATGATGATGATGATGATGAGAACCCCCATTAATTTCTGCTTCTATAGTTTTTATTTCATC
  • a Restriction sites are underlined (BamHI and PstI for pQE30 and BglII and StuI for pLUG345).