TABLE 2.

PCR primers used for expression analysis

PrimerSequenceAnnealing temp (°C)Fragment length (bp)
SAP1a (5′)TACTTGTGATAAACCTCGTCCTG58.9
SAP1b (3′)ATCATCATCCAAATCATAAACAAG54.2831
SAP2a (5′)GTTGATTGTCAAGTCACTTATAGTG56.1
SAP2b (3′)TCTTAGGTCAAGGCAGAAATCTGG59.3898
SAP3a (5′)CAAGTTCTTCAAGTAGTTCTCAAAAT56.9
SAP3b (3′)CCCTAAGTAAGAGCAGCAATGT58.4826
SAP4a (5′)CCGTTGGTATTGGTGGTGTT57.3
SAP4b (3′)AGGAACGGAAATCTTGAGG54.5532
SAP5a (5′)CGATGAGACTGGTAGAGATGGTG62.4
SAP5b (3′)TTCGGAAACAGGAACGGAG56.7870
SAP6a (5′)AAACCAACGAAGCTACCAGAAC58.4
SAP6b (3′)TAACTTGAGCCATGGAGATTTTC57.1605
SAP7a (5′)TCTTCTTCACTGGAAGCTGC57.3
SAP7b (3′)AGGAACAACGGCATGGTTATC57.91,199
SAP8a (5′)TGGCTCAAGGTCTTGCTATC54.0
SAP8b (3′)CTCTATAAAGTAGAAATACTTGA51.71,163
SAP9a (5′)CTCAATACTGCCGATGC50.8
SAP9b (3′)TAAACCAAAACATAGTAGGATA52.8738
SAP10a (5′)GATCTGCTGCTCAAGGTGTATG60.3
SAP10b (3′)AAGAGTGGCCAAGAGCATCA57.3437
SAP4c (5′)GGTTCCAGATTCAAATGCCG60.0
SAP4d (3′)CTTTCTATCATCCAAATCGTAG60.0855
SAP5c (5′)TGAGACTGGTAGAGATGGTG60.0
SAP5d (3′)GGTTTACCACTAGTGTAATATGT62.0902
SAP6c (5′)AAACCAACGAAGCTACCAGAAC64.0
SAP6d (3′)TAACTTGAGCCATGGAGATTTTC64.0605
EFB1a (5′)AGTCATTGAACGAATTCTTGGCTG65.0
EFB1b (3′)TTCTTCAACAGCAGCTTGTAAGTC65.0564/928 (cDNA/DNA)