TABLE 2.

Primers used in this studya

PrimerSequence
AvrF1AGAAGGCGTTATCTACTTGC
AvrB1GCTCTAGAGGACTTAGCATACTTTTCCCTC
AvrF2GCTCTAGACGTCTGTGTGGTGAAGAAC
AvrB2TTAGCGGTGAGTCTGTCAG
SipAF1AGGCGGCTACTAAAATCC
SipAB1GCTCTAGATACCTGGCATTATGACGGG
SipAF2GCTCTAGAGGTCATTACTCATCATCC
SipAB2CAAGCGAGAGAAAAATACTACAC
SopAF1AAAGATGGCTGGAGAGCGAG
SopAB1GCGAGCTCTGGTTATTTTTGAGGTGAG
SopAF2GCGAGCTCGAACAGTTTACCGAGTGGTC
SopAB2TGAATGCGTCTGGCGAAAGC
SopB1CCCGTATTTGGTTCTGAATCTCC
SopB2AGCCTGAAACTGGTATCCGTGG
SopDFGCGATATCTGGGGGGTTGGGATAAAGTC
SopDBGCTCTAGATAAGCGAGTCCTGCCATTCG
SopE1GACTAACATAACACTATCCACC
SopE2TCAGGAGGCATTCTGAAGATAC
SptpF1GCGAAAAAGTATCAAGACATTG
SptpB1GCTCTAGATAAAGTCGGGCATCATTC
SptpF2GCTCTAGATTCATTGTCTGGGCGGAG
SptpB2ACGGTAAAATCTGAGAGAGG
SspHF1AGGCGTTGGGCGAATCTATC
SspHB1GCTCTAGATTCAGCGAGACACTGTTGC
SspHF2GCTCTAGACAACACTGGAACAGATTGC
SspHB2TACGCCCTGACTGAAGAAG
Z-SipA1GCGAGCTCACGACAACCTGGTAAAAG
Z-SipA2GCGAGCTCCTATCAACATCAACGGCA
LacZ1CTCTTCGCTATTACGCCA
LacZ2CATAAACCGACTACACAAA
  • a The restriction endonuclease sites incorporated into the primer sequences are underlined.