TABLE 2.

Primers used for site-directed mutagenesis

CloneGene or ORFMutagenic primer
Δivi814 bglG GCCGCAAAGCGGTAGATCTGGCAAGTTATGACGGAG
Wild type bglG GCCGCAAAGCGGTAGAGGGCAAGTTATGACGGAG
Δivi814 o761 GGATCAAGTTATCTAGAAAAAGGCGTGTTTTCAAGCCAGCAATAACGAAATAATTGCCG
Wild type o761 GGATCAAGTTATCTGAAAAAGGCGTGTTTCTCGCCAGCAATAACGAAATAATTGCCG
Δivi815 ycjF GCAAAAGCAATATTCAGCAAGGTACCAGCTTAAACAGGC
Wild type ycjF GCAAAAGCAATATTCAGCAATACCAGCTTAAACAGGC
Δivi816 clpB CCCGGATAAATTCACGATCGCGTTTAATAAAAGAATGGATCC
Wild type clpB CCCGGATAAATTCACGTTCGCGAATAAAAGAATGGATCC
Δivi817aGCCGTAGCGATTTAAAGATGCAATAACGGCG
Wild typeGCCGTAGCGATTTAGATGCAATAACGGCG
Δivi818ORF VCATCACCAGGATGGCTTTAAAGCAATAAGAGTTGGCC
Wild typeORF VCATCACCAGGATGGCTTTGAGCAATAAGAGTTGGCC
Δivi819 aroA CAGTCTTATCAGTCCCCGGGTAGCTATTTGG
Wild type aroA CAGTCTTATCAGTCTCCGGGTACTTATTTTGG
  • a —, no similarity to sequences in GenBank.