TABLE 1.

Primers used in this study

DesignationSequence (5′→3′)
Primer 1AGTAATGCTGCTCGTTTTGC
Primer 2GACAGAGCCGACAGAACAAC
439NheGGGGGCTAGCGTTTGTTACGGGGCAACGGG
SK1MGGGGAGATCTAATTGTCTTGTATTTATTTG
LONGGGGAGATCTATTTTGACTCATAGAGG
LOFFGGGGAGATCTAAACTGTCTATATCATAAATAAG
439BamGGGGGATCCAACAACTTCCCCTTTAAAGTG
DRA1GGGGGATCCGCTGCTTTCCTTTAAAAAAAC