TABLE 1.

16S rRNA gene group-specific and kingdom-specific primers for qPCR

GroupReference strainPrimerSequence (5′-3′)Temp (°C) at last stepReference
Eubacteria (All bacteria)Ruminococcus productus (ATCC 27340D)UniF340ACTCCTACGGGAGGCAGCAGT631
UniR514ATTACCGCGGCTGCTGGC63
Eubacterium rectale-Clostridium coccoidesR. productus (ATCC 27340D)UniF338ACTCCTACGGGAGGCAGC6013
C.cocR491GCTTCTTTAGTCAGGTACCGTCAT60
Lactobacillius/LactococcusLactobacillus acidophilus (ATCC 4357D)LabF362AGCAGTAGGGAATCTTCCA5633
LabR677CACCGCTACACATGGAG56
BacteroidesBacteroides fragilis (ATCC 25285D)BactF285GGTTCTGAGAGGAGGTCCC6111
UniR338GCTGCCTCCCGTAGGAGT61
MIBMIB plasmid CT11-6Uni516FCCAGCAGCCGCGGTAATA5835
MIBR677CGCATTCCGCATACTTCTC58
SFBSFB plasmid CTL5-6SFB736FGACGCTGAGGCATGAGAGCAT5837
SFB844RGACGGCACGGATTGTTATTCA58
Salmonella enterica serovar TyphimuriumS. Typhimurium (ATCC 700720-D)Sal454TGTTGTGGTTAATAACCGCA5624
Uni785RGACTACCAGGGTATCTAATCC563
EnterobacteriaceaeE. coli (ATCC 10798D)515FGTGCCAGCMGCCGCGGTAA6723
826RGCCTCAAGGGCACAACCTCCAAG67