TABLE 1.

Primers used for real-time qRT-PCR

GeneForward primer (5′-3′)Reverse primer (5′-3′)
RPS-9CGCAGGCGCAGACGGTGGAAGCCGAAGGGTCTCCGCGGGGTCACAT
MCP-1CGCACTCTCGCCTCCAGCATGAAGCGCGAGCCTCTGCACTGAGATCTTC
IL-8CCTACAACAGACCCACAACAATACATGCTGATGGAAGAGAGCTCTGTCTGGAC
MIP-2αTAGGTCAAACCCAAGTTAGTTCAATCGATTCCTCAGCCTCTATCACAG
MIP-2βAAGAAGCTTATCAGCGTATCATTGACTTTCTTACGAGGGTTCTACTTATTTATG
RANTESCTCCCAAGCTAGGACAAGAGCAAGTCCAACCCAGCAGTCGTCTTTG
IP-10GTTTTAAGGAGATCTTTTAGACATTTCCTCTAAGTGGGCATTCAAGGAGTAC
MCP-1aCCTGCTTGCTGGTGATTCCTCTTGATGCCATGCAGGTCCCTGTCATGC
GAPDHaTGCACCACCAACTGCTTAGGATGCAGGGATGATGTTC
  • a Mouse gene.