TABLE 2.

Primers used in this study

Locusa or primer nameSequence (5′-3′)aUse
ForwardReverse
ers CGCGGATCCATAATAGATAATTGAGGTTGCTGCATCTTTTTCATGGRT-qPCR
ef0082TTGACGTCAGCACCTTCTTCCGTAGCGTTCACCTTTGACART-qPCR
ef0049CAGCTTTTCCGACACGTCTTTTCCCCCACGTACTTTAGCART-qPCR
ef0782TTAGAGCGCGCAGTGAATCATGGCCGATCTGCTTCTAAART-qPCR
ace ATGAAGGAAGCCCACAGTTGGTTGTGCCTGTTTTGGGAAGRT-qPCR
kat GCTGTTTGGGATTTTTGGTCCATGCATATGACGGAACGACRT-qPCR
ef1656TTTATTTGTCACCCAACCAACACAATTGAAACGGTTGATCAGAART-qPCR
ef1664TGGCGACCTAATTACCTTGGCGTTTGCATCGTACGTGAGTRT-qPCR
ef1816CGTCAAGACGATACCCGATTTTTCCATGTTGTGCAGGAAGRT-qPCR
ef2185GCGATTGCTCCAACTGAATCGCCGTCCGTAATAAAAAGCART-qPCR
ef3146CCAGAATTCTCAATTCCTCGTTCAAATTTTTGTACACCGACAGGRT-qPCR
aceRace1ATTCCAACTAGTGCGTCTGG5′RACE PCR
aceRace2TTGAGGTCATCTCTCCTTG5′RACE PCR
aceRace3TCAATTCGGCGCCAAACGAA5′RACE PCR
Prom-aceTCATTCTTTTCCTCCTTATCTCCGCAATTGGTAGAATCATTACloning in pGEM-T
Prom-ersTAAGTTTGGTTCTGTCATTACGACTCGAAAGGAATGTTCACloning in pGEM-T
aceDC-UbCCGGAATTCAGCTCAACTATGCCTGTCGACGCGGATCCGTCATTCCAACTAGTGCGTCCloning in pMAD
aceDC-DbCGCGGATCCCAGCCATCCACAGAAACAACGAAGATCTTTCCTCTGCCATTAACGCGTCloning in pMAD
p3535ersCGCGGATCCATAATAGATAATTGAGGAGTTACGCGCGCTGCAGTTAAACAATAATGTTATCTCTAATCCloning in pMSP35535
pQE30-ersHTHGCGGATCCAAAAAGATGCAGCAAATGTTGATCGCGCGCTGCAGTTAAACAATAATGTTATCTCTAATCCloning in pQE30
mad1F TCTAGCTAATGTTACGTTACACCloning verification
mad2R TCATAATGGGGAAGGCCATCCloning verification
Pu GTTGTAAAACGACGGCCAGTCloning verification
Pr CACAGGAAACAGATATGACCCloning verification
  • a From the annotated sequence available at http://www.tigr.org .

  • b Primers used to clone upstream (U) and downstream (D) sequences of ace in order to construct a deletion mutant and complemented strain by a double-crossover (DC) event.