TABLE 1.

Primer pairs used in RT-PCR analysis of the gene cluster containing shp

PrimeraSequence (5′→3′)Amplicon size (bp)
shpF GATAAAGGTCAAATTTATGGATG 755
shpR CCAAACCCATACAGCAAACC
shpF GATAAAGGTCAAATTTATGGATG 1,271
1795R GGCTTTTTCTTCCCCTTACG
1795F ATTGTAGCCACTTCGGTTGC 1,329
1794R GCTGAGGTGAAAAAGCTGGT
1794F GGCAATTGTCAAGGGACTGT 1,538
1793R AAGTCGCCCATCTTTCAGTC
1793F CCATCAAGTGGTCGAAGGTT 1,751
1791R AGACTGGCGTTTCAAGAGGA
1791F TGGGAATTGGTTTGTCAGGT 5,115
1787R CCAAAAGACTAGCGGCAATC
  • a Numbers correspond to SPy gene designations in GAS strain SF370. F, forward; R, reverse.