TABLE 2.

Features of etd pathogenicity island ORFs

ORF no.GeneLocation (bp)G+C content (%)Size (aa)Translation signalaHomologue as determined by BLAST and/or FASTA
SourceDescriptionIdentity (%)Overlap (aa)Accession no.
4IS2561089-226136.57390 AGGAGGACTTTTACATG S. aureus IS256100390/390 P19775
5 hsdS 2393-361328.75406 GGGGTGTTGAAAGATG S. aureus N315Probable restriction-modification system specificity subunit3730/403 BAB41621.1
6 hsdM 3606-516238.66518 GGAGGAATCACATG S. aureus N315Probable type 1 site-specific DNase Lldl chain HsdM98518/518 BAB41620.1
1 etd 5409-625431.21281 AAGGAGTTTTATTATG S. aureus ETB66267/268 AB036767
2 orf5 6410-710830.76233 GAGGTGTAAATTGTG B. intermedius Glutamyl endopeptidase25186/303 CAC17594.1
3 edin-B 7154-789731.32247 GGAGATGAATTTAAATATG S. aureus EDIN-B99212/212 AJ277173
7 orf7 8082-991424.28610 TAAGGGATGATTAGAAAATATG L. lactis AbiK46519/599 AAB53491.2
8 orf8 9979-1080030.29273 GGAGGAATGAGTATG S. aureus N315; SA2005Conserved hypothetical protein98271/271 BAB43296.1
9 orf9 11088-1151330.75141 AAGGAGATTGAGATATG S. aureus N315; SA2006Hypothetical protein, similar to major histocompatibility complex class II analogue99141/141 BAB43297.1
10 orf10 11887-1259133.76234 GGAAATTTTATG S. aureus N315; SA2007Hypothetical protein, similar to alpha-acetolactate decarboxylase97234/234 BAB43298.1
11 orf11 12628-1429235.2554 GGAAATGAATATAAATG S. aureus N315; SA2008Alpha-acetolactate synthase98554/554 BAB43299.1
  • a Underlining indicates the putative ribosomal binding site; boldface indicates the start codon.