TABLE 1.

Primers used in this study

GenePrimerOligonucleotide sequence (5′→3′)Location within gene (bp)Size of amplified product (bp)
eta ET-1CTATTTACTGTAGGAGCTAG46-65741
ET-2ATTTATTTGATGCTCTCTAT767-786
etb ET-3ATACACACATTACGGATAAT167-186629
ET-4CAAAGTGTCTCCAAAAGTAT776-795
ET mixed primerET-7GCWACHGGWGTDTTAATWGGWAAA
ET-8ATTAAATATACCTGATCCAGA
etd ET-14AACTATCATGTATCAAGG289-306 (5697-5714a)376
ET-15CAGAATTTCCCGACTCAG647-664 (6055-6072a)
pCL8-etdET-18ACTCGCATCCATGTTTCC5067-5084a1,398
ET-19GATAGTTAGCAACTAATAG6446-6464a
His6-etaET-21CCATGGAAGTTTCAGCAGAAGAAATAA115-136739
ET-22GGATCCTCATTTTTCTCGTTTATAATGCG816-840
His6-etbET-23GCATGCAAGAATACAGCGCAGAAGAAATC95-117752
ET-27GGATCCTTTATCTAATTTTGCTCTCTTTTTCA806-831
His6-etdET-25GCATGCAAACATATGAAGAATCTGAAATT100-120 (5508-5528a)758
ET-26AGATCTATGAGACTGTAATTCAGCTCT823-843 (6231-6251a)
edin-B ednB-1CATAAATACTCCTCTAAG243-260 (7384-7401a)444
ednB-2GCATATTCTGTCCCTCTA669-686 (7810-7827a)
tst-1 TSST-1CTGCTACAGATTTTACCC59-78477
TSST-2GAGTTAGCTGATGACGAA518-535
sea sea-1CATTGCCCTAACGTTGAC33-50665
sea-2ATACTGTCCTTGAGCACC670-697
seb seb-1GTATGGTGGTGTAACTGAGC666-685164
seb-2CCAAATAGTGACGAGTTAGG810-829
sec sec-1AGATGAAGTAGTTGATGTGTATGG432-455451
sec-2CACACTTTTAGAATCAACCG863-882
sed sed-1CTAGTTTGGTAATATCTCC40-58713
sed-2ATATGAAGGTGCTCTGTGG734-752
OthersET-28TATGGTCGATTGCGAATG5093-5110a
ET-29CTACACAAGTACTTACACCG7979-7998a
ET-40CTCATATAGGTTATATTTTG8775-8794a
ET-85CATGTACATCAGACTGCCTTGTATAAGATTTGAAA665-699a9,432
ET-86GATGTCGAATAGTAGAGATGAAGCATTAAAGCAGA10062-10096a
  • a Location within 14,849-kb etd pathogenicity island.