TABLE 2.

Oligonucleotides used in this study

NameSequence (5′→3′)Predicted amplicon size (bp)
narH RT S5′GAGATCGACGACTACTACGAACC 3′677
narH RT AS5′CACCTGCTCCACGCTCAACC 3′
GroEL F15′CGCTCGCAAGAAAATGCTGGTC 3′550
GroEL R15′CGACGGACAGTTCGTTTTCCAG 3′
nirS RT S5′AGGTCGTTGAGCTGTTTCTTCG 3′437
nirS RT AS5′GCCAAGGACGACATGAAAGC 3′
ExoU RT S5′GGGAATACTTTCGGGAAGTT 3′428
Exo U RT AS5′CGATCTCGCTGCTAATGTGTT 3′
PcrV RT S5′ATGGAAGTCAGAAACCTTAATGCC 3′629
PcrV RT AS5′AAATCCTTGATCGACAGCTTGC 3′
ExoT RT S5′CATATTCAATCATCTCAGCAGAACC 3′398
ExoT RT AS5′AGTCTCTCCTCTGTCAAAGTCG 3′
RhlA RT S5′GAAAGTCTGTTGGTATCGGTTTGC 3′494
RhlA RT AS5′TATTGCCGACGGTCTCGTTG 3′
LasB RT S5′TTTCTACGCTTGACCTGTTGTTCG 3′635
LasB RT AS5′TACTTGCCGATCTTCTGGTTGC 3′
ToxA RT S5′TCAGTCATCGCCTGCATTTC 3′460
ToxA RT AS5′CTCGCGTTGATAGGGTGACC 3′