TABLE 1.

Sequences of primers used in the RT-PCR

GenePrimer sequences (5′-3′)a
fslA GACAAGCTACTTCATCCGAGTCTA,
TTAGCTGATATTGCTGGTATCCAT
fslB GCAAAGGTAACTCCAAGTATGAATC,
TGCAATATCCACTGTAGCAATTTA
fslC AATATGACAATGTAGCCCAGCTAA,
TCTAGATTTGGATTTGCCTTAACA
fslD GGCTCCAAGTAGGTGAGCTATTA,
GGTGAATCAGCATTTAACACAAAT
fslE CGCCAAAGAATATCGAATAACTATC,
ACCTTCTTAGGAGCATACTCTGGT
FTT0918CAGTATTCCAATTGGTCAGATTTC,
GCTTCTATAAAGCCACCAAAGAAT
  • a Forward and reverse primers are indicated on the top and bottom lines, respectively.