TABLE 1.

B. anthracis strains, plasmids, and oligonucleotides used in this study

Strain, plasmid, or nucleotideRelevant genotype or sequence (5′→3′)Source or reference
Strains
    7702Sterne strain; pXO1+Laboratory stock
    RBAF1407702 pagA-lacZ transcriptional fusion integrated adjacent to pagA53
    RBAF1437702 lef-lacZ transcriptional fusion integrated adjacent to lef53
    RBAF1447702 cya-lacZ transcriptional fusion integrated adjacent to cya53
    7702-XFI7702 atxA-lacZ transcriptional fusionJ.-C. Sirard, personal communication
    BATX17702 ΔatxA52
    7CodYS7702 codY::spcThis study
    140CodYSRBAF140 codY::spcThis study
    143CodYSRBAF143 codY::spcThis study
    144CodYSRBAF144 codY::spcThis study
    7CodYSXFI7702XFI codY::spcThis study
    7702XF57702 atxA-lacZ translational fusionThis study
    7CodYSXF57702XF5 codY::spcThis study
Plasmids
    pUC1318SpcLaboratory stock35
    pBADExpression vector21
    pBAKSuicide vector in B. anthracis34
    pBALA20lacZ-carrying vector36
    pAT187Conjugative replicating plasmid used for complementation in B. anthracis; Kanr62
    pAT113Conjugative suicide plasmid61
    pGEMT-easyCloning vectorPromega
    pQE30Expression vectorQiagen
    pTAX5atxA-harboring plasmid20
    pSALAC10lacZ-harboring plasmidThis study
    pJP15pBAD derivative harboring codY under control of araBAD promoterThis study
    pAtlac30pAT113 derivative harboring atxA-lacZ translational fusionThis study
    pAtxAc4pQE30 derivative harboring atxAThis study
    pCodY4pAT187 derivative harboring codYThis study
    pCOD30pBAK derivative harboring interrupted allele of codYThis study
    pXF1pAT113 derivative harboring atxA-lacZ translational fusionJ.-C. Sirard, personal communication
Oligonucleotides
    CompCodYFGCTGGGATCCGAAGATTTATCGTTTGAAGCATCTG
    CompCodYRGGTGGGATCCGAGGAGAGTTTTATAAATTAGTTTG
    LacZ-NGGATCCACCATGATTACGGATTCACTGGCCGTCGTT
    LacZ-CCCCGGTTATTATTATTTTTGACACCAGACC
    AtxAFGGATTCCTAACACCGATATCCATCGAAAAGGAACATATAAG
    AtxARAAGCTTGGGCATTTATATTATCTTTTTGATTTCATGAAAATCTCTTTCTGTAGG
    atxA-F-ACACTTTTGCATCCATACGTTCTTGGGCAATT
    atxA-R-AGGATCCTCGGACTGTTTTATCTGCGACCTGTAGATA
    oPJ33GCGCTTTCAAAAATAGAAGAATACCTCATT
    oPJ36CCTCCTTCAGGAATATGCTACTAGTTTTAC
    oPJ37GGTATGGTAATTTTGAAAAATCTAACGCTA
    oPJ38CGACAAAAAAGTGAATTTTCACAATTCCAA
    qPCR-atxA1-FACAGGTCGCAGATAAAACAGTCC
    qPCR-atxA1-RGAACAAGTAAATTCCAAGATGGAGGA
    qPCR-atxA2-FTCTGCACTGCTTGAAAAACG
    qPCR-atxA2-RCCATGTCTTGGAGTGATTCGTTA
    qPCR-tuf-FGCCCAGGTCACGCTGACTAT
    qPCR-tuf-RTCACGAGTTTGAGGCATTGG