TABLE 1.

Primers used in this study

PrimerNo.Sequencea
sen-F-NdeI15′ CTACGGCCATATGTCAATAATAACTGATGTGTATGCTCG 3′
sen-R-BamHI25′ CGCGGATCCTTTTTTTAAGTTATAGAATGATTTGATACC 3′
sen-ΔK43535′ CGCGGATCCTACTATTTTAAGTTATAGAATGATTTGATACC 3′
sen-ΔK434-43545′ CGCGGATCCTACTATAAGTTATAGAATGATTTGATACC 3′
sen-K435L55′ CGCGGATCCTACTATAATTTTAAGTTATAGAATGATTTGATACC 3′
sen-K434-435L65′ CGCGGATCCTACTATAATAATAAGTTATAGAATGATTTGATACCTTTG 3′
sen-K428-434-435L75′ CGCGGATCCTATAATAATAAGTTATAGAATGATAAGAVACCTTTGTA 3′
sen-DST-F85′ CTGCAGATTAGTCTAGUGGACTCATTTATCC 3′
sen-DST-R95′ CATATGTGTTGAGCAACTAGCTGCTTTGACG 3′
sen-F-SalI105′ ACGCGTCGACATG TCAATAATAACTGATGTGTATGCTCG 3′
spc-1-F115′ GGTACTTACATGTTTGGATCAGG 3′
spc-2-R125′ CCATTCAATATTCTCTCCAAG 3′
sen-C-F135′ GGTGAAGTTGCUCAATACAAAGG 3′
sen-DST-N-R145′ CACATTCTACGAATGACC 3′
sen-DST-C-R155′ CGACAGAGCAGTTGATATCTTGG 3′
  • a Restriction sites introduced into the primer sequences are underlined.