TABLE 1.

Sequences of primers used for real-time RT-PCR

GeneForward primerReverse primer
dcaAGATATGCCGATTTCAGATTGTCAACAGGTGGCTGATTGGCTTGT
fecBCGCCATTCTGCCGTCTATGTGCGGTTTCAAGGTTTTCTTG
fnrGCGGGTGATCCATTAAATTCTCTTCGCCTGGTAACTGAAATGAAGT
glpQACAAGATCTCGCAATGACGAAAGCTCGCTCGATTTGGGAATTTT
gyrBGCCCTTTCCGATAAATTGCAAATCGCGGCTAATGGTGCTT
hexCGCTCGCGCACAAGATGATACTAAAACTGGCGGATAGGGATACTTT
lppAAGCTGATAGCCAAGGAGTTCTTGCGTTGCAATCATTTGACCAGTAC
lppCGGCGTCTATATTGTTGCCATGATACTGCGCGAACTGGCATAA
pm0209AATTTTGGGTGCTGTTTGAAGTGATAAAGACTTTCGCTTGCAATGC
pm0453CAACATCAAGATAAGCTTCCCGTTAGCCTGCATTAGCAAACACGAA
pm1269GAAGAAACGATCCCTTGTCCCAGGAAAGCGATCACAGCCAT
rpoETCACAAAACGACATTCCTGATGTTGCCATGTGTAGAAAGCACTGTCA
yfeBTGCCCTTGCCCAACAAAGTGATCCAACAATGCCATAATCG
yfeCGGAAAATTAGCGACGATTGCATAAACCGCCTGTTGCTCCAT