TABLE 2.

Major primers used in this study

PrimerDNA sequence (5′-3′)aProduct size (bp)Target gene or function
PF1AAAGGATCCCAAAATGTAGAACTAGATAGC (BamHI)2,043cfrA (no signal peptide region)
PR1AAACCCGGGAAAGTTACCATTGATAGAAAT (SmaI)
CHFL1TTTGCTAGCTGCTCGGCGGTGTTCCTTT (NheI)802cat
CHFR1TTTGCTAGCGCGCCCTTTAGTTCCTAAAG (NheI)
CfrAFGAGATGTTGCAGAGGCTATCG527cfrA
CfrARTGCCTTTGTAGGACTTTGAGC
CfrAF1TCAATATTTAACAAAAGGAGAAAAATG2,151cfrA (complete open reading frame)
CfrAR1AAGCCTTTGAAAGCTCTTTGG
CfrAF2TTTCATTGGGTTGTATGTGTAAAAA1,631Part of cfrA plus 445-bp upstream region
CfrAR2TCTGCAAAAATTGCCAATAAA
CfrAR3TCTGCAAAAATTGCCAATAAANAbcfrA sequencing primer
Q271A_FGATAATAAACAAGGTGCATTAGGAACCATCACAAGTCCAGGTAGAACACC9,300Create Q271A mutation in CfrA
Q271A_RGGTTCCTAATGCACCTTGTTTATTATCATAATGATTTC
K297A_FGAAGTTGATGCATTTGTGACTTATTTAAGTCATG9,300Create K297A mutation in CfrA
K297A_RGTCACAAATGCATCAACTTCCATAATATCTGC
R327A_FGATGGCGCAGAAGTCGTAGGGCAATCTACACAGCCG9,300Create R327A mutation in CfrA
R327A_RGACTTCTGCGCCATCATTGCTCACTCTATTATATTG
F337A_FCACAGCCGGCTTTGGGAGAAAATAGAGATATAGTC9,300Create F337A mutation in CfrA
F337A_RCTCCCAAAGCCGGCTGTGTAGATTGCCCTACGACTTCGCGGCC
  • a Restriction sites in the primer sequences are underlined, and the restriction enzymes are indicated in parentheses. Bold type indicates nucleotides designed for amino acid substitution mutagenesis.

  • b NA, not applicable.